От лямблий лекарство: Купить препараты от лямблий: Киев, Днепр, Харьков, Одесса, Львов поиск лекарств по всей Украине | Цены на средства от лямблий в интернете

alexxlab Разное

Содержание

ТРИХОПОЛ: эффективное лечение лямблиозной инфекции!

Вот и пришло долгожданное лето — теплые солнечные дни, школьные каникулы, длительные прогулки на свежем воздухе, купания в водоемах. Во дворах с утра до вечера звучат детские голоса и веселый смех. Однако многие родители не задумываются, какая опасность подстерегает их малышей в песочнице во время игры со сверстниками, при общении с домашними животными, в озере и речке, при употреблении свежих фруктов и ягод. С приходом лета риск инфицирования детей лямблиями, паразитирующими в тонкой кишке и желчном пузыре, возрастает многократно.

Проблема лечения и профилактики лямблио­за еще долго не утратит своей актуальности, поскольку лямблии (Lamblia intestinalis или Giardia intestinalis) широко распространены в окружающей среде и человеческой популяции. Так, их выявляют у 2–7% населения развитых стран и у 20–60% — развивающихся. (Thompson R.C.A. et al., 1990; Al-Saeed A.T., Issa S.H., 2006).

Заражение происходит при употреблении содержащих цисты лямблий продуктов питания и воды (особенно не подвергшихся термической обработке), при контактах с зараженными людьми, в случае несоблюдения правил личной гигиены. Вероятность инфицирования цистами лямб­лий возрастает у детей, имеющих вредную привычку грызть ногти, держать во рту карандаши, ручки. Для малышей одним из главных источников инфекции является песочница, загрязняемая фекалиями кошек и собак.

Течение лямблиозной инфекции может быть как острым, так и хроническим. Острый лямблио­з чаще всего отмечают у детей раннего возраста, он характеризуется лихорадкой, рвотой, диа­реей, краснухоподобной или кореподобной сыпью, анорексией, резкой болью в верхней и средней эпигастральной области, вздутием кишечника.

Нередко таким пациентам устанавливают диагноз «кишечная инфекция неясной этиологии» и без специального обследования на лямблиоз. Острый период длится несколько дней, после чего лямблиоз чаще всего переходит в под­острую или хроническую стадию.

Хронический лямблиоз сопровождается интоксикацией, гиповитаминозом, диспепсическими явлениями, дисбиозом кишечника. Характерными являются диарея, схваткообразная боль в животе, тошнота, снижение аппетита, симп­томы нарушений общего состояния (головная боль, раздражительность, недомогание, быстрая утомляемость, эмоциональная лабильность, гипотрофия, у детей — отставание в физическом развитии, уменьшение массы тела, крапивница.

Один из препаратов выбора в лечении лямб­лиоза — ТРИХОПОЛ компании «Польфарма», качество, эффективность и безопасность которого отечественные врачи и пациенты по достоинству ценят уже 30 лет. Действующее вещество препарата — метронидазол, обладающий противопротозойным и противомикробным эффектом, — является производным 5 нитро­имидазола.

Для лечения лямблиоза ТРИХОПОЛ может применяться у детей в возрасте старше 6 лет в дозе 375 мг/сут в 3 приема; у взрослых и детей в возрасте старше 12 лет — по 1-2 таб. 3 раза в сутки. Препарат следует принимать во время или после еды, проглатывая таблетку целиком. Курс лечения составляет около 7 дней.

Не секрет, что проверенные и востребованные пациентами лекарственные средства наиболее часто становятся объектами фальсификации. Заботясь о репутации своего препарата, компания «Польфарма» использует различные современные методы защиты упаковки ТРИХОПОЛА от подделок. Так, оригинальную упаковку легко отличить визуально: надпись «Польфарма» темнеет при повороте упаковки на 90°, а при освещении прибором на лазерной основе становится заметна надпись «ОК».

Использование вышеперечисленных элементов защиты позволяет пациенту гарантировано приобрести оригинальный продукт, а фармацевту дает уверенность, что на полках аптеки находится высококачественный брэнд.

Сегодня ТРИХОПОЛ — эффективное лекарственное средство для лечения лямблиоза, трихомониаза, амебиаза и анаэробных инфекций, а его подлинность надежно защищена!

Пресс-служба «Еженедельника АПТЕКА»

Дорожная аптечка для очаровательной леди

Цікава інформація для Вас:

Лямблиоз: лекарства, используемые при лечении

Лямблии — одноклеточные паразиты, которые обитают в тонкой кишке человека.

Общие сведения

Бактерии вызывают лямблиоз — распространенную кишечную инфекцию, которая чаще всего встречается среди детей и людей с некоторыми видами нарушения пищеварения.

Причины лямблиоза

Нарушение пищеварения. Если в просвет кишечника выделяется мало ферментов, то создаются более благоприятные условия для размножения лямблий.

Особенности питания. Потребление большого количества углеводной пищи активирует размножение лямблий. Во время голодания и белковой диеты количество паразитов уменьшается.

Снижение кислотности желудочного сока. Чем меньше в желудке кислоты, тем проще через него проходят лямблии.

Желчь в небольшом количестве также стимулирует размножение лямблий.

Несоблюдение личной гигиены. Чаще всего лямблии попадают в организм с немытыми овощами и фруктами.

Симптомы

Лямблиоз может проявляться по-разному. При острой форме заболевания возникает тошнота и рвота, жидкий стул, снижение аппетита, боли в верхней части живота и вокруг пупка, вздутие живота. Эти симптомы продолжаются, как правило, в течение нескольких дней, а затем стихают. После этого заболевание переходит в хроническую форму. Периодически происходят обострения, во время которых возникает вздутие живота и жидкий стул. Со временем появляются жалобы на повышенную утомляемость, снижение массы тела, головные боли.

У детей лямблиоз нередко является причиной таких нарушений, как дискинезия желчевыводящих путей, реактивный панкреатит (кратковременное нарушение функций поджелудочной железы).

Более чем в половине случаев лямблии никак себя не проявляют. У больных отсутствуют симптомы.

Что можете сделать вы при лямблиозе

При возникновении болей в животе, жидкого стула, тошноты, рвоты, вздутия живота необходимо обратиться к врачу. В зависимости от тяжести состояния, можно явиться на прием к инфекционисту или вызвать бригаду «Скорой Помощи».

Если периодически возникают симптомы, напоминающие обострения лямблиоза, то нужно посетить терапевта, гастроэнтеролога или инфекциониста.

Что может сделать врач

Для того чтобы обнаружить лямблии, врач-инфекционист назначает паразитологические исследования:

  • Анализ кала на лямблии.
  • Анализ на лямблии сока поджелудочной железы, полученного во время зондирования.
  • Лечение лямблиоза проводится противопаразитарными препаратами.

Профилактика лямблиоза

Профилактика лямблиоза заключается в тщательном соблюдении правил личной гигиены. При выявлении лямблиоза нужно немедленно провести лечение, чтобы предотвратить заражение окружающих.

Внимание! Карта симптомов предназначена исключительно для образовательных целей. Не занимайтесь самолечением; по всем вопросам, касающимся определения заболевания и способов его лечения, обращайтесь к врачу. Наш сайт не несет ответственности за последствия, вызванные использованием размещенной на нем информации.

Лямблиоз у детей | Захарова И.Н., Авдюхина Т.И., Дмитриева Ю.А., Будаева Е.К., Скоробогатова Е.В.

По данным Всемирной организации здравоохранения (ВОЗ), лямблиозом страдают примерно 20–25% детей в мире. Лямблии занимают 3-е место по распространенности после энтеробиоза и аскаридоза (ВОЗ, 2006). Ранее считалось, что лямблиоз встречается в эндемичных районах Азии, Африки, Латинской Америки с плохо развитой инфраструктурой. В связи с развитием туризма в развивающихся странах лямблиоз встречается повсеместно, нередко совместно с возбудителями кишечных инфекций и гельминтозов, таких как Hymenolepis nana, Strongyloides stercoralis, Taenia spp. и т.д. С 2004 по 2010 г. в мире было зарегистрировано 70 вспышек лямблиоза, связанных с водным путем передачи инвазии [1]. За 2010 г. в Европе было зафиксировано 17 130 случаев лямблиоза, что составило 5,68 на 100 тыс. населения.

Заболеваемость лямблиозом зависит от социально-экономического уровня стран. В развитых странах она встречалась с частотой 2–7%, в развивающихся – достигает 40% [2]. У детей Африки, Азии, Южной Америки лямблии вызывают хроническую диарею, медленно приводя к серьезным нарушениям питания, снижению иммунитета, функциональным расстройствам со стороны нервной системы.
В настоящее время проводятся международные геномные исследования, изучаются патогенетические механизмы развития лямблиоза, разрабатываются современные тесты для максимально быстрого выявления лямблий в кале зараженных, ведется активный поиск возможности разработки вакцин, путей контроля над данной инфекцией, поиск и оценка новых и старых схем лечения лямблиоза. По-прежнему дискутируется вопрос о необходимости лечения носителей лямблиоза. Однако последние исследования осложнений лямблиоза как у взрослых, так и у детей, после крупных вспышек этого заболевания в Европе и в развивающихся странах показали важность постоянного контроля над данной инфекцией. Если ребенок, заболевший лямблиозом, находится в контакте с носителем лямблий, как внутри семьи, так и в детском учреждении (детские сады, дома ребенка), то рекомендуется полная санация всех членов семьи и выявленных носителей в детском учреждении [3, 4].
В настоящее время морфологически дифференцируются 6 видов лямблий: Giardia intestinalis, Giardia muris, Giardia agilis, Giardia microti, Giardia ardeae, Giardia psittaci. Giardia intestinalis (G. duodenalis, L. intestinalis) может вызвать инфекцию у человека и различных видов млекопитающих. Внедрение в практику молекулярных генетических исследований позволило идентифицировать 8 основных генетических подтипов внутри видового комплекса L. intestinalis (A–H). Лямблиоз человека связан с двумя подтипами А и В лямблий, внутри которых также имеются внутригрупповые различия (AI–АIII, ВIII–В1V). Лямблии, поражающие человека, могут также инфицировать большое количество других видов млекопитающих, как в дикой природе, так и домашних животных. Поэтому лямблиоз рассматривается как зоонозное заболевание, причем возможна передача как от человека к животным, так и от животных к человеку.
К внутривидовым фенотипическим различиям лямблий различных генетических подтипов относятся различия [5, 6]:
1. в процессе метаболизма;
2. в скорости роста и размножения;
3. в устойчивости к лекарствам;
4. в переносимости pH желудочного содержимого;
5. в «инфекционности» цист;
6. в сроках эксцистирования и инцистирования;
7. в наборе факторов вирулентности;
8. в клинических проявлениях заболевания.
Разнообразие клинической картины лямблиоза определяется видом лямблии, вызвавшей инвазию, а также зависит от состояния здоровья человека. Результаты исследований, проведенных в Бангладеш, Перу, Испании, показали взаимосвязь диарейного синдрома у детей с подтипом АI и АII лямблий, тогда как инвазии, вызванные подтипом В в этих же странах, чаще протекали бессимптомно. В Руанде инвазии подтипом А сопровождались рвотой и болями в животе, подтипом В протекали бессимптомно, но приводили к тяжелым нарушениям питания [7]. Ученые из Саудовской Аравии и Кубы, наоборот, показали взаимосвязь диарейного синдрома с подтипом В лямблиоза. Наиболее часто диарейный синдром встречался при совместных инвазиях различных подтипов G. intestinalis, при этом отмечалось более тяжелое течение заболевания [3, 7, 8].
Клинические и экспериментальные данные показывают, что организм инфицированного лямблиями человека формирует адаптивный иммунный противолямблиозный ответ, т.к. есть данные, что в ряде случаев пациенты, зараженные лямблиями, выздоравливают самостоятельно без лечения. У взрослых, проживающих в эндемичных районах по лямблиозу, отмечается меньшая частота эпизодов инфекции, либо заболевание протекает в легкой форме, нежели у людей, приезжающих из других стран. В развивающихся странах, эндемичных по лямблиозу, лямблии являются убиквитарными паразитами, дети могут инфицироваться ими с первых месяцев жизни, при этом достаточно быстро развивается адаптивный иммунитет, защищающий детей от повторного заражения. Первая инвазия лямблиями в некоторых случаях может вызвать острую диарею у детей, но чаще протекает легко или бессимптомно, что может быть объяснено тем, что дети в развивающихся странах до 1 года чаще вскармливаются грудным молоком, содержащим высокие концентрации специфических антилямблиозных IgA-антител, а также лактоферрин [9]. Эти защитные компоненты не предотвращают развития хронического лямблиоза или его носительства, но предотвращают более тяжелые эпизоды острой диареи. При анализе взаимосвязи эндемичной диареи у детей в развивающих странах с L. intestinalis было выявлено, что в этом регионе инвазия L. intestinalis в 3 раза чаще вызывает хронический диарейный синдром, а не острую диарею, как это часто бывает у детей в развитых странах [9]. В основе различий в клинической картине лямблиоза у детей из развивающихся стран, по сравнению с детьми из развитых стран, как предполагают авторы, лежат отличия микроархитектоники тонкой кишки. У детей из развитых стран микроворсинки щеточной каемки тонкой кишки высокие, в ее проксимальных отделах обитает сравнительно небольшое количество бактерий, в собственной пластинке слизистой оболочки отмечается умеренное количество лимфоидных клеток. В «нормальном» кишечнике у детей из развивающихся стран ворсинки щеточной каемки укорочены, в двенадцатиперстной кишке отмечается высокий рост различной флоры, а собственная оболочка слизистой кишечника характеризуется гиперклеточностью, т.е. в ней присутствует большое количество лимфоидных элементов. Совокупность данных изменений тонкой кишки у детей, проживающих в бедных, фекально контаминированных условиях в развивающихся странах, называются «тропической энтеропатией», или «энтеропатией окружающей среды». Авторы предполагают, что 3-кратное увеличение частоты хронического диарейного синдрома при лямблиозе у детей в развивающихся странах может быть связано как с врожденными, так и с постепенно развивающимися нарушениями иммунитета на фоне длительного нарушения питания [9]. Тем не менее, при отсутствии адекватного иммунного ответа со стороны человека лямблиоз встречается чаще и протекает тяжелее. Высокая частота лямблиоза отмечается у людей с иммунной патологией различной этиологии при общем вариабельном иммунодефиците, селективном IgA-дефиците, первичном иммунодефиците, СПИДе.
Приобретенный иммунитет после перенесенного лямблиоза нестойкий, возможно неоднократное повторное заражение, как тем же видом лямблий, так и другими видами, с которыми человек встречается при путешествиях в другие регионы мира. По данным разных авторов, в основе этого лежат и особенности организма человека, и высокая антигенная изменчивость лямблий, а также большое генетическое разнообразие видов лямблий, обитающих у человека. Разработанные до настоящего времени вакцины для животных не защищают их от повторного заражения. В настоящее время ведутся исследования, направленные на поиск веществ, способных ингибировать антигенную изменчивость лямблий [10].
Изучение жизнедеятельности лямблий с помощью современных методик показало, что течение лямблиоза у конкретного индивида обусловливается двумя факторами:
1. количеством и качеством инфекта, подтипом A или B L. intestinalis (различные подтипы лямблий обладают различным набором факторов вирулентности, наиболее тяжелое течение заболевания отмечается при одновременной инвазии у человека различными подтипами (A и B) L. intestinalis).
2. состоянием здоровья человека (организм человека обладает мощным набором защиты: врожденные и приобретенные факторы иммунитета, неспецифические факторы защиты от различных патогенов).
Факторы вирулентности лямблий, представляющие особенности жизнедеятельности этого паразита, обусловливают инвазию организма, рост и размножение паразита в организме, патогенное действие на организм человека и его распространение в окружающей среде [11].
Локализуясь в области щеточной каемки ворсин кишечника, лямблии многократно присасываются и открепляются от эпителиальных клеток, чем вызывают механическое повреждение энтероцитов. Помимо этого, они выделяют продукты метаболизма, обладающие токсическим действием, и конкурируют за всасывание пищевых веществ. Среди защитных факторов организма против лямблий рассматриваются такие неспецифические факторы, как муциновый барьер и перистальтика кишечника, наличие в просвете кишечника протеаз, липаз, желчных кислот, бактерий кишечной микробиоты, клеток Панета. К факторам врожденного иммунитета, защищающим от лямблий, относятся: оксид азота, лактоферрин, дефензины, фагоциты, тучные клетки, дендритные клетки. К факторам приобретенного иммунитета: IgA-антитела, Т-клетки [12]. Кишечные муцины, покрывающие поверхность кишечного эпителия, представляют собой крупные гликопротеины высокой плотности, обладающие резистентностью к протеазам и способные удерживать воду. На основании структуры и места расположения различают два вида муцинов: связанные с мембраной энтероцитов и секретируемые в просвет кишечника. Секретируемые в просвет кишечника муцины участвуют в создании на кишечной стенке муцинового геля, выполняющего барьерную функцию первой линии и препятствующего адгезии различных кишечных патогенов к стенке. Было доказано, что ингибирование прикрепления трофозоитов лямблий вызывают такие составляющие муцинового геля, как N-ацетилгалактозамин, N-ацетилглюкозамин, манноза и глюкоза. Основным компонентом муцинового геля, препятствующим размножению лямблий, являются IgA-иммуноглобулины [13].
Кишечная микробиота имеет чрезвычайно важное биологическое значение в элиминации лямблий из организма человека и животных [14]. Исследования взаимодействия различных бактерий кишечной микробиоты и лямблий выявили, что бактерии кишечной микробиоты могут прямо или опосредованно влиять на клиническое течение лямблиоза. Различные механизмы могут быть в основе защитной роли микрофлоры от воздействия лямблий [13]:
• конкуренция за связывание рецепторных зон на поверхности муцинового барьера кишечника;
• химическая структура поверхностных антигенов бактерий кишечной микробиоты обусловливает пространственные затруднения для адгезии патогена к муциновому барьеру кишечника;
• продукция антимикробных веществ;
• конкуренция за питательные субстраты;
• улучшение работы факторов врожденного и приобретенного иммунитета при заболевании.
Показано, что кишечная микробиота влияет на патогенность лямблий, но не на размножение паразита [15]. Автор на моделях гнотобионтных животных изучал патоморфологические изменения, а также проводил подсчет цист и трофозоитов в тонкой кишке у мышей трех групп: стерильных, обычных и гнотобионтных, которым приживлялись компоненты микробиоты двенадцатиперстной кишки детей с клинически выраженным лямблиозом. Наиболее выраженные деструктивные изменения слизистой кишки были выявлены в группе обычных мышей с полностью сформированной кишечной микробиотой. В группе стерильных мышей патологических изменений слизистой не было, в группе гнотобионтных мышей, которым приживлялась кишечная микробиота от детей с клинически выраженным лямблиозом, изменения имели промежуточный характер. Количество цист между группами не различалось. Полученные данные подтверждают, что бактерии кишечной флоры стимулируют патогенность лямблий. Компоненты доминантной кишечной микробиоты двенадцатиперстной кишки детей с клинически выраженным лямблиозом могут частично стимулировать патогенность лямблий у гнотобионтных животных. Однако ни одна из комбинаций микробиоты, выделенных из двенадцатиперстной кишки больных лямблиозом детей, не смогла полностью стимулировать патогенность лямблий, как это делает сформированная кишечная микробиота обычных мышей [15].
Singer и соавт. (2000) показали, что введение в пищу пробиотиков влияет на клиническое течение лямблиоза у мышей. Восприимчивость к лямблиозу была ниже у группы мышей, которые вскармливались смесью пробиотиков (Lactobacillus acidophilus, Lactobacillus salivarius, Bacteroides distasonis, Flexistipes phylum, Firmicutes, Bacillus-Clostridium) [16]. Изучение влияния кишечной флоры на течение лямблиоза стимулировало поиск компонентов кишечной микробиоты, обладающей антилямблиозной активностью. В настоящее время накоплены данные, что лактобациллы препятствуют адгезии и пролиферации трофозоитов [17]. Исследованиями Peres и соавт. в 2001 г. in vitro был доказан антагонистический эффект Lactobacillus Johnsonii La1 на трофозиты лямблий [18]. M.С. Humen и соавт. в 2005 г. in vivo доказали антилямблиозный эффект Lactobacillus Johnsonii La1. Авторы предположили, что лактобациллы усиливают иммунные реакции против лямблий у зараженных животных, приводя к их излечению [19].
В 2011 г. N. Goyal и соавт. показали, что L. rhamnosus GG обладает более высокой приживляемостью в ЖКТ по сравнению с другими лактобациллами, быстро колонизирует кишечник и защищает организм животного от лямблий [17]. Поэтому можно сказать, что L. rhamnosus GG является наиболее эффективным и безопасным средством для профилактики и лечения лямблиоза у мышей. Эти же авторы установили, что модулирующий эффект L. rhamnosus GG у зараженных лямблиями мышей обусловлен усилением гуморального и клеточного иммунного ответа на инфекцию. Авторы предлагают использовать L. rhamnosus GG как терапию, восстанавливающую микрофлору кишечника и усиливающую местный иммунитет в кишечнике. Таким образом, использование различных пробиотиков может значительно усилить защитные барьеры организма и быть рекомендовано как для профилактики, так и для лечения лямблиоза [17].
Диетотерапия при лямблиозе должна состоять из пищи с высоким содержанием клетчатки и низким содержанием легкоусвояемых углеводов и жиров. Эта диета обеспечит поступление достаточного количества лигнина и растворимых и нерастворимых волокон, что может увеличить секрецию защитных муцинов в тонкой кишке, связать желчные кислоты, а также будет способствовать механическому удалению лямблий со стенки тонкой кишки. Употребление небольшого количества легкоусвояемых углеводов необходимо для уменьшения их количества в просвете кишечника, что может снизить осмотические потери воды в просвет кишечника и уменьшить диарейный синдром [13]. В ряде случаев необходимо ограничение молочных продуктов у пациентов с непереносимостью лактозы.
Целью лечения лямблиоза является не только эрадикация паразита, но и ликвидация (уменьшение) клинических проявлений – абдоминального синдрома, эндогенной интоксикации, аллергических и вегетативных нарушений. Применение этиотропного лечения приводит к массивному распаду паразитов и всасыванию продуктов их распада в кровь, что может быть причиной усиления интоксикации и сенсибилизации организма. Клинически это проявляется на 2–3-й день лечения в виде ухудшения самочувствия пациента, появления тошноты, рвоты, ухудшения аппетита, усиления зуда и высыпаний на коже. Такая реакция носит название реакции Яриш–Герксгеймера. Указанные явления самопроизвольно купируются в течение 2–3 дней и не требуют отмены терапии.
Этиотропное лечение лямблиоза назначают при обнаружении возбудителя и наличии клинических проявлений болезни. При выборе препарата для лечения лямблиоза у детей главное требование – это безопасность, а также отсутствие рецидивов заболевания. При выборе этиотропного средства для лечения лямблиоза следует иметь в виду, что широко применявшиеся ранее препараты группы нитроимидазола, фуразолидон теряют свою актуальность в связи с появлением большого количества устойчивых к ним штаммов паразитов.
В настоящее время для лечения лямблиоза используется четыре группы противолямблиозных препаратов: нитроимидазольная группа (метронидазол, тинидазол, альбендазол, орнидазол и ниморазол), нитрофураны (фуразолидон), производные бензимидазола (альбендазол) и препараты, содержащие акридин (мепакрин и квинакрин), которые используются только у взрослых в связи с их возможной высокой токсичностью (табл. 1).
Сравнительная эффективность препаратов, применяемых при лечении лямблиоза у детей, представлена в таблице 2. Даны препараты, наиболее оправданные для лечения лямблиоза, с указанием формы их выпуска, дозировок, длительности курса, побочных эффектов и сравнительной эффективности.
Ингибитор тубулина бензимидазольного ряда – альбендазол является наиболее перспективным новым препаратом в лечении лямблиоза. Соединения этой группы обладают весьма специфическим антипаразитарным действием и значительно безопаснее для человека, чем традиционно применяемые нитроимидазолы. Альбендазол и его метаболиты проникают в разные участки трофозоитов лямблий. Его низкая токсичность, относительно низкая растворимость и низкая всасываемость из кишечника, а также отсутствие неблагоприятного эффекта на нормальную кишечную флору делают данный препарат прекрасным заменителем метронидазола в лечении лямблиоза у человека. Альбендазол тормозит поглощение глюкозы мышечными клетками личинок и взрослых форм гельминтов, чувствительных к препарату, истощает запасы гликогена и уменьшает образование АТФ, что приводит к иммобилизации и гибели гельминта. В ЖКТ абсорбируется около 30% альбендазола. В печени происходит превращение препарата в активный метаболит – альбендазола сульфоксид, который оказывает специфическое действие на лямблии. Биодоступность повышается в 5 раз при приеме препарата с жирной пищей. Альбендазола сульфоксид на 70% связывается с белками плазмы и широко распределяется в различных органах. Он определяется в моче, желчи, печени, ЦНС, стенках кист. Выводится из организма в виде различных метаболитов с мочой. Незначительная часть препарата выводится желчью.
Стандартная дозировка альбендазола при лечении лямблиоза у детей старшего возраста и взрослых составляет 400 мг/сут. в течение 5 дней, у детей – 15 мг/кг массы в сутки в течение 5–7 дней [20, 21]. Альбендазол эффективен при лечении резистентных к метронидазолу штаммов лямблий [22]. В настоящее время на российском рынке представлен препарат альбендазола Саноксал. Одним из существенных преимуществ данного препарата является выпуск его в форме жевательных таблеток, удобных в применении для детей и людей, которым трудно проглотить обычные таблетки.
В Бангладеш проводилось сравнительное исследование [21] эффективности различных доз альбендазола и метронидазола у детей, страдающих лямблиозом. Через 10 дней после окончания лечения троекратно проводилось микроскопическое исследование стула. Эффективность альбендазола составила: в группе пациентов, получавших препарат в дозе 600 мг однократно, – 62%, в дозе 800 мг однократно – 75%, в группе пациентов, получавших альбендазол в дозе 400 мг/сут. в течение 3-х дней – 81% и в группе пациентов, получавших альбендазол в дозе 400 мг/сут. в течение 5 дней, – 95%. Таким образом, альбендазол в дозе 400 мг/сут. в течение 5 дней оказался высокоэффективным (95%), сравнимым с эффективностью метронидазола (97%, n=230). Авторы сделали вывод, что альбендазол может являться альтернативным препаратом при лечении инфекций, вызванных Giardia duodenalis.
A.K. Dutta и соавт. (1994) сообщили о результатах проведения рандомизированного контролируемого мультицентрового исследования эффективности и безопасности применения препаратов альбендазол и метронидазол при лечении лямблиоза у детей. 150 детей обоих полов в возрасте от 2 до 10 лет были рандомизированы в 2 группы, равнозначные по количеству участников: группа 1 – получала альбендазол (суспензию) 400 мг 1 раз/сут. в течение 5-ти дней, группа 2 – метронидазол 22,5 мг/кг/сут. в 3 приема в течение 5-ти дней. Исследование стула проводилось через 2 дня после окончания терапии: в обоих группах лямблии в стуле отсутствовали у 97% пациентов. Побочные эффекты отмечались у 3-х детей в группе альбендазола и у 20 детей в группе метронидазола. Таким образом, при лечении лямблиоза у детей эффективность альбендазола (суспензия) была сравнима с эффективностью метронидазола. Однако прием альбендазола сопровождался меньшими побочными реакциями, чем прием метронидазола [20].
В 2010 г. S. Mohammadi и соавт. был опубликован метаанализ публикаций по изучению эффективности метронидазола и альбендазола в лечении лямблиоза. В работе оценивались результаты 8 рандомизированных клинических испытаний, в которых участвовали 900 человек. Альбендазол использовался однократно в дозе 400 мг/сут. в течение 5 сут., а метронидазол в дозе 250 мг – 3 раза/сут. у взрослых и из расчета 15 мг/кг в сут. у детей трехкратно в течение 5–7 дней. Данное исследование выявило, что альбендазол и метронидазол обладают одинаковой эффективностью при лечении лямблиоза, альбендазол обладает более низким риском развития побочных эффектов при его приеме в сравнении с метронидазолом, и, кроме того, высокая противогельминтная активность препарата позволяет успешно использовать его в случаях смешанных инвазий [23].
После окончания курса лечения любым из перечисленных препаратов необходимо через 2–3 нед. провести контрольное паразитологическое обследование. Отсутствие цист лямблий при контрольном исследовании не может считаться критерием излеченности больного. В этой ситуации основное значение в оценке эффективности терапии имеет исчезновение клинических симптомов. Кроме того, следует помнить о возможности повторного инфицирования, т.к. распространенность лямблиозной инвазии в детской популяции достаточно велика. При достижении клинической ремиссии дети должны продолжать наблюдаться педиатром с последующим 2–3-кратным обследованием проб фекалий.
Инвазированные лямблиями люди, не знающие о наличии у них инвазии, представляют особую угрозу в качестве источников инвазии. Не имея достаточной информации, они не получают лечения и не принимают мер предосторожности, чтобы не заразить тех, кто с ними общается. Знание основных мер профилактики лямблиоза поможет предотвратить заражение этой инвазией многих групп людей – туристов, путешественников, персонал детских учреждений и др.
Изучение особенностей клиники, эпидемиологии и профилактики лямблиоза, а также совершенствование идентификационных и количественных методов его диагностики – задача для научного поиска и наблюдений практических врачей.

Литература
1. Baldursson S., Karanis P. Waterborne transmission of protozoan parasites: review of worldwide outbreaks — an update 2004-2010 // Water Res. 2011. Vol. 15; 45(20). P. 6603–6614.
2. Julio C., Vilares A., Oleastro M. et al. Prevalence and risk factors for Giardia duodenalis infection among children: A case study in Portugal. Parasites & Vectors, 2012. Vol. 5. P. 22.
3. Supaluk Popruk, Kanthinich Thima, Ruenruetai Udonsom et al. Does silent Giardia infection need any attention? // Open Tropic. Med. Journal. 2011. Vol. 4. P. 26–32.
4. Ioan C.C., Ursu C. Giardiasis: controversy subject and prevention requirements. Agronomy Series of Scientific Research, Lucrari Stiintifice Seria Agronomie, University of Agricultural Sciences & Veterinary Medicine of Iasi. 2012. Vol. 55 (2). P. 393–396.
5. Jerlstrom-Hultqvist J., Franzen O., Johan Ankarklev et al. Genome analysis and comparative genomics of a Giardia intestinalis assemblage E isolate // BMC Genomics. 2010. Vol. 11:543. P. 1–15.
6. Benere E., Van Assche T., Cos P., Maes L. Variation in growth and drug susceptibility among Giardia duodenalis assemblages A, B and E in axenic in vitro culture and in the gerbil model // Parasitol. 2011. Vol. 138. P. 1354–1361.
7. Ignatius R., Bosco Gahutu J., Klotz C. et al. High Prevalence of Giardia duodenalis Assemblage B: Infection and Association with Underweight in Rwandan Children, PLOS // Neglected tropical disease. 2012. Vol. 6, Issue 6. e1677.
8. Koh WH, Geurden T, Paget T. et al Giardia duodenalis assemblage-specific induction of apoptosis and tight junction disruption in human intestinal epithelial cells: effects of mixed infections. J Parasitol. 2013 Apr; 99(2): 353-358;
9. Khitam M., Myron M. Levine A Systematic Review and Meta-analysis of the association between Giardia lamblia and endemic pediatric diarrhea in developing countries. Clinical infectious disease // Global enteric multicenter study (GEMS). 2012. Vol. 55, (Suppl. 4). P. 271–276.
10. Rivero F.D. et al. Disruption of antigenic variation is crucial for effective parasite vaccine // Nature med. 2010. Vol. 16, № 5.
11. Jerlstrom-Hultqvist J., Franzen O., Johan Ankarklev et al. Genome analysis and comparative genomics of a Giardia intestinalis assemblage E isolate // BMC Genomics. 2010. Vol. 11:543. P. 1–15.
12. Roxstrom-Lindquist K. et al. Giardia immunity – an update // Trends in Parasitol. 2006. Vol. 22, № 1. Р. 26–31.
13. Hawrelak J. Giardiasis: pathophysiology and management // Alternat. Med. Review. 2003. Vol. 8, № 2. P. 129–141.
14. Berrilli F. et al. Interactions between parasites and microbial communities in the human gut // Frontiers in сellular and infection microbiology. 2012. Vol. 2, № 141. P 1–6.
15. Torres M.F., Uetanabaro A.P., Costa A.F. et al. Influence of bacteria from the duodenal microbiota of patients with symptomatic giardiasis on the pathogenicity of Giardia duodenalis in gnotoxenic mice // J. Med. Microbiol. 2000. Vol. 49(3). P. 209–215.
16. Singer S.M., Nash T.E. The Role of Normal Flora in Giardia lamblia Infections in Mice // J. Infectious Diseases. 2000. Vol.181. P.1510–1512.
17. Nisha Goyal, Ram Prakash Tiwari and Geeta Shukla. Lactobacillus rhamnosus GG as an Effective Probiotic for Murine Giardiasis Interdisciplinary Perspectives on Infectious Diseases. Vol. 2011, ID 795219. P 1–4.
18. Perez P. et al. Inhibition of giardia intestinalis by extracellular factors from lactobacilli: an in vitro study // Applied and environmental microbiology. 2001. P. 5037–5042.
19. Humen M.A. et al. Lactobacillus johnsoni i La1 antagonizes giardia intestinalis in vivo // Infection and immunity. 2005. Vol. 73, № 2. P. 1265–1269.
20. Dutta A.K., Phadke M.A., Bagade A.C. et al. A randomised multicentre study to compare the safety and efficacy of albendazole and metronidazole in the treatment of giardiasis in children // Ind. J. Pediatr. 1994. Vol. 61(6). P. 689–693.
21. Hall A., Nahar Q.Trans R Albendazole as a treatment for infections with Giardia duodenalis in children in Bangladesh // Soc. Trop. Med. Hyg. 1993. Vol. 87(1). P. 84–86.
22. Lemee V., Zaharia I. et al. // J. Antimicrob. Chemother. 2000. Vol. 46. P. 819–821.
23. Shahram Solaymani-Mohammadi, Jeanine M. Genkinger, Christopher A. Loffredo et al. A Meta-analysis of the Effectiveness of Albendazole Compared with Metronidazole as Treatments for Infections with Giardia duodenalis. PLOS // Neglected tropical disease. 2010. Vol . 4 , Issue 5. e 562.

.

Препараты для детей от лямблий и паразитов

Ключевые теги: препарат от паразитов полынью, средства от паразитов бактефорт, Купить Detoxic средство от паразитов в Мариуполе.


Препараты для ребенка от паразитов, Купить Detoxic средство от паразитов в Мариуполе, Купить Detoxic средство от паразитов в Латвии, гомеопатия средства от паразитов, Купить Detoxic средство от паразитов в Кургане.

Принцип действия

Трава золототысячника обыкновенного Способствует восстановлению поврежденных тканей, снимает воспаление и останавливает кровь Трава тысячелистника обыкновенного Уничтожает и выводит из организма паразитов на всех стадиях их развития

Препараты и схема лечения лямблий у детей. Как лечить детей по Комаровскому? Народные средства против лямблий у детей. Важно для лечения детей использовать не только антипротозойные препараты, но и энтеросорбенты, которые позволяют быстро и качественно очистить организм ребенка от … Как правильно лечить лямблии у детей. Обзор лучших средств и препаратов для борьбы с ляблиозом. Пошаговые действия. этапы лечения от паразитов.


Официальный сайт Detoxic средство от паразитов

Состав

Обзор лекарств от паразитов человека; классификация препаратов для лечения гельминтозов и избавления от простейших микроорганизмов. Чем лучше вывести паразитов у беременных и детей. Важно для лечения детей использовать не только антипротозойные препараты, но и энтеросорбенты, которые позволяют быстро и качественно очистить организм ребенка от токсинов. Что это такое — Лямблии?Схема леченияНародные Средства лечения ЛямблиозаКак точно определить Заражен ли Ребенок Лямблиями?Заражение: Шаг за шагомЭти паразиты относятся к простейшим. Их строение предполагает наличие всего лишь одной клетки.Размеры паразитов чрезвычайно малы, не превышают 18 мкм, а передвигаются они посредством жгутиков. В эпидемиологическом плане заражение паразитами предполагает наличие фекально-орального механизма передачи.See more on netparazitam.comПрепараты от лямблий для детей, народные средства борьбы с …vekzhivu.com/article/2665-preparaty-ot-lyamblii-dlya-detei…Лекарственные препараты от лямблий для детей продаются в различных формах – таблетки, сироп, суспензия, поэтому для любого возраста можно подобрать самую удобную и …

Результаты клинических испытаний

Лечение для детей. Малышам следует давать препараты, имеющие минимальное количество возможных побочных реакций. Средство от паразитов для детей должен назначить лечащий врач. 7/27/2017«Какое лекарство от лямблий является наиболее эффективным для взрослых и детей. Народное лечение лямблиоза и вспомогательные препараты, особенности терапии. … Средство от паразитов для … Таблетки от лямблий у взрослых и детей могут вызывать серьезные побочные эффекты. Препараты для лечения лямблиоза содержат вещества, которые уничтожают паразитов.

Мнение специалиста

Заболевания, вызванные паразитами, по частоте проявлений уступают лишь простудным. Средств против паразитов сейчас немало, но одним из первых появился именно Detoxic, за десять лет он успел зарекомендовать себя, как надежное средство с наиболее быстрым результатом. Я прописываю Detoxic своим пациентам для лечения и профилактики паразитных заражений.

Что такое цисты и чем они опасны для организма, как лечиться от цист лямблий. Местом обитания цист, являются стоячие открытые водоемы, немытые фрукты и овощи, грязные руки детей, детские … Препараты от лямблий для детей … рынок предоставляет возможность приобрести любое лекарство от лямблий для детей и эффективно избавиться от них в кратчайшие сроки. … Таблетки от лямблий …

Способ применения

Для взрослых : Применять 2 раза в день за 30 мин до еды. Курс приема 30 дней. Для детей 6 – 12 лет : Применять 2 раза в день за 30 мин до еды. Курс приема 20 дней.

Лекарственные препараты от лямблий для детей продаются в различных формах – таблетки, сироп, суспензия, поэтому для любого возраста можно подобрать самую удобную и эффективную форму. Таблетки от лямблий у взрослых и детей могут вызывать серьезные побочные эффекты. Препараты для лечения лямблиоза содержат вещества, которые уничтожают паразитов. Данный препарат разрешён для применения детей от двух лет, что указывает на безопасность использования для маленьких детей. Тинидазол. Назначают при остром и длительном течении лямблиоза.

Как заказать?

Заполните форму для консультации и заказа Detoxic. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Обзор лекарств от паразитов человека; классификация препаратов для лечения гельминтозов и избавления от простейших микроорганизмов. Чем лучше вывести паразитов у беременных и детей. Препараты для лечения лямблий у детей … Таблетки от лямблий для детей: … Это лекарство токсично для анаэробных форм паразитов и оказывает разрушающее воздействие на их ДНК. У …

Купить Detoxic средство от паразитов в Тюмени, безопасное средство от паразитов в организме человека, препарат от паразитов токсинов и шлаков, препараты против паразитов у человека, профилактическое средство от гельминтов, препарат от паразитов на птице, гельминты как от них избавиться от.
Официальный сайт Detoxic средство от паразитов

Купить Detoxic средство от паразитов можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша


А я и не слышал до этого ни о чём таком. А тут вот оно как. Оформил заказ, вот звонили минут 20 назад, сказали, что постараются быстрее доставить.

Вот ведь. А у меня две дочки маленькие, как раз болеют постоянно и вообще какие-то вялые всегда. А у одной ещё и проблемы с кишечником постоянно. Я как статью прочла, аж руки похолодели. Уже оставила на том сайте заявку, жду когда позвонят.

Извиняюсь, не заметила на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

Лямблиоз | Лечение хронических заболеваний

Лямблиоз – это инфекционное заболевание тонкого кишечника и печени, возбудителем которого являются микроскопические паразиты — лямблии (Lamblia intestinalis).

Лечение лямблиоза. Экологическая медицина человека

В клинике экологической медицины накоплен большой опыт безопасного излечения лямблиоза. Чем это обусловлено:

  • при обращении пациента в поликлинику или больницу с симптомами энтерита, холецистита или астении не всегда выявляется лямблиозное происхождение болезни. В результате пациента лечат от симптомов болезни, не воздействуя на причину;
  • продолжительная жизнедеятельность лямблий, воздействие их метаболитов на организм формирует синдром хронической эндогенной интоксикации и вторичной иммунной недостаточности. В дополнение к этому противопаразитарная терапия вызывает иммунодефицит. Лечение этих нарушений средствами аллопатической медицины крайне неэффективно, а экологическая медицина использует методики, которые излечивают хроническую интоксикацию, нарушения иммунитета, дисбактериоз и аллергию. В клинике применяются натуропатические и гомеопатические препараты без побочных эффектов, которые ликвидируют дефицит витаминов и аминокислот, восстанавливают ферментативную активность.
Причины заболеваемости и факторы риска

Источником инфекции может быть не только больной человек, но и кошки, собаки и мышевидные грызуны. Цисты лямблий обнаруживаются в хлорированной воде из-под крана, в загрязненных водоемах. Достаточно проглотить всего 10 цист лямблии, чтобы заразиться лямблиозом.

Различают три пути передачи лямблиоза — водный, контактно-бытовой и пищевой. Заражение происходит чаще всего при употреблении плохо очищенной водопроводной воды или воды из открытых водоемов. В случае контактно-бытового пути заражение осуществляется через загрязненные цистами предметы обихода — белье, игрушки, посуду. У детей, имеющих вредные привычки, такие как кусание ногтей, карандашей и ручек, практически в 100% случаев выявляются лямблии. Возможно заражение при употреблении инфицированных цистами пищевых продуктов без термической обработки (овощи, ягоды, фрукты). Отмечены случаи заражения лямблиозом при незащищенном анальном сексе. Факторами риска являются отсутствие навыков личной гигиены, плохие санитарные условия. Эндогенным фактором, способствующим заражению лямблиями, является пониженная кислотность желудочного сока.

Симптомы:
  • боль в животе;
  • понос;
  • метеоризм;
  • головная боль;
  • снижение аппетита;
  • повышение температуры;
  • тошнота, реже рвота;
  • общее недомогание.
Течение заболевания

Период между заражением и появлением клинической симптоматики заболевания составляет 7-28 дней. Часто наблюдается острое течение лямблиоза. Острая фаза длится 2-4 недели. При нетяжелом течении может быть спонтанное выздоровление. У детей, лиц с пониженным иммунитетом острый лямблиоз может перейти в хроническую форму.

Диагностика

Наиболее достоверными методами диагностики являются обнаружение наличия лямблий в кале дуоденальном содержимом. Также проводится серологическая диагностика лямблиоза — выявление специфических антител.

Лечение лямблиоза методами аллопатической медицины:
  • противопаразитарная терапия;
  • ликвидация токсикоза, улучшение ферментативной активности кишечника, коррекция иммунологического статуса;
  • антигистаминные препараты и энтеросорбенты;
  • ликвидация дисбиоза.
Осложнения

Течение лямблиоза может осложняться следующими проявлениями:

  • снижение массы тела, отставание в физическом развитии;
  • дискинезия желчевыводящих путей со спазмом или атонией сфинктеров, холестаз;
  • присоединение гастрита, гастродуоденита, панкреатита;
  • токсико-аллергические осложнения: крапивница, отек Квинке, атопический дерматит;
  • возможно поражение суставов.

Лямблиоз у кошек — Новости Видаль

Лямблиоз — паразитарное заболевание, вызываемое простейшими Giardia. Он протекает в виде носительства, острых или хронических (рецидивирующих) нарушений со стороны различных органов и систем.

Впервые роль этих паразитов, как возбудителей болезни, описал чешский медик-анатом В.Д. Ламбль еще в 1859 году. Он установил, что они, прикрепляясь к слизистой тонкой кишки, начинают питаться переваренной пищей человека или животного. В результате организм недополучает белки, жиры, углеводы, снижается иммунитет, возникают кишечные расстройства.

Лямблии обитают в просвете тонкой кишки. В организме лямблии имеют две формы существования – вегетативную (трофозоит) и в виде спор (цист). В вегетативной форме лямблии преимущественно находятся в верхних отделах тонкой кишки. При попадании в толстую кишку вегетативные формы превращаются в цисты, которые выделяются с испражнениями во внешнюю среду. Цисты также долго живут в воде.

Заражение лямблиозом у кошки происходит фекально-оральным путем, а источником является зараженная цистами лямблиоза вода или пища. Нередко лямблиоз протекает бессимптомно, и тогда кошка становится носителем инфекции и представляет угрозу для людей.

Клиническая картина лямблиоза зависит от возраста кошки и состояния ее иммунной системы. Симптомы лямблиоза у кошек часто бывают не характерными и проявляются в виде небольших расстройств со стороны кишечника или общего недомогания и сонливости. У некоторых кошек заболевание может стать причиной хронической диареи. При сохранении нормального аппетита владельцы животного отмечают снижение веса, фекалии мягкие и водянистые, желтого или зеленого оттенка с дурным запахом, иногда с содержанием слизи или частиц крови. В результате паразитирования лямблий, поступающие в организм животного жиры и витамины не усваиваются, что внешне проявляется сухостью кожи, шерсть теряет свой блеск, становится ломкой и  выпадает.

Для постановки диагноза на лямблиоз, учитывая циклическое выделение цист и трофозоитов с фекалиями, незначительные сроки жизни вегетативных форм во внешней среде, необходимо проводить лабораторные исследования фекалий животных в острой фазе заболевания. При получении отрицательного результата на лямблиоз исследования повторяют трехкратно.

Лечение животного должно проводиться под контролем ветеринарного врача с использованием противопаразитарных средств и дополнительно назначают энтеросорбенты, пробиотики. Для контроля эффективности лечения проводят повторное исследование фекалий по окончании лечения.

Главным в профилактике лямблиоза у кошек является соблюдение санитарно-гигиенических правил ухода за животными.

Кошки с хорошим иммунитетом практически не болеют лямблиозом, поскольку проникающие в организм цисты сразу же гибнут. Для поддержания крепкого иммунитета следует обеспечить животному полноценное питание, а при необходимости добавлять в пищу витамины, предназначенные для кошек.

Источник

причины, симптомы, признаки, диагностика (анализы), лечение (диета), профилактика у взрослых и детей

Опубликовано: 26.10.2021 15:20:00    Обновлено: 26.10.2021   Просмотров: 17722


Лямблиоз – протозойная инвазия, вызываемая простейшими лямблиями, которые поражают тонкий кишечник. Проявляется расстройством пищеварения. Впервые этот возбудитель инфекции описал чешский доктор Д. Ф. Лямбаль в 1859 году. Его именем в дальнейшем назвали не только паразита, но и заболевание.

По данным ВОЗ, каждый год лямблиями во всем мире заражается около 200 миллионов человек. Чаще всего это происходит в странах Азии, Африки, Латинской Америки. По официальным данным, в России каждый год выявляется до 150 тысяч заражений этими простейшими.

Нередко лямблиоз является причиной расстройства кишечника у детей дошкольного и младшего школьного возраста. У взрослых в основном он протекает бессимптомно.

Причины

Лямблия – это простейший микроскопический одноклеточный паразит из класса жгутиковых. В кишечнике человека он может находиться в двух формах – вегетативной и споровой. Размножаются лямблии путем деления и удваиваются в количестве каждые 10-12 часов. Местом обитания вегетативных форм служит верхний отдел тонкого кишечника. Цисты же неподвижны, имеют овальную форму и защищены капсулой. В этой форме лямблии существуют в толстой кишке, а также во внешней среде. Так они могут длительное время оставаться жизнеспособными.

Основные причины лямблиоза – попадание в организм человека цист. Происходит это при употреблении в пищу немытых овощей и фруктов, нарушениях правил гигиены, использовании некипяченой воды. Такой путь передачи носит название фекально-оральный, так как источником распространения возбудителей лямблиоза является зараженный человек, который выделяет цисты вместе с фекалиями. Также носителями лямблиоза могут быть домашние животные, а переносчиками выступают мухи и тараканы.

Провоцирующими факторами могут стать скученность людей, проживание в загрязненной окружающей среде, плохое состояние систем водоснабжения и канализации, несоблюдение санитарно-гигиенических правил. Предрасположенность к болезни выявлена у детей в возрасте до 10 лет, у людей с наличием гипотрофии или дистрофии, врожденными пороками желчевыводящих путей, заболеваниями желудка и кишечника со сниженным уровнем кислотности, а также у придерживающихся диет со слишком низким содержанием белка.

Классификация

Признаки лямблиоза могут быть незаметны в четверти всех случаев. Такое состояние называется бессимптомным носительством. При этом сам человек не является заболевшим, но он становится источником инфекции для других.

У половины всех пациентов с лямблиозом заболевание протекает субклинически. Они также не имеют симптомов и не считают себя заразившимися. Выявить болезнь здесь помогает только диагностика.

И только у оставшегося процента пациентов заболевание имеет ярко выраженные симптомы, которые могут протекать остро, подостро или хронически.

Симптомы

Лямблиоз часто имеет стертые симптомы и протекает без выраженных клинических проявлений. При типичной форме болезни первые симптомы начинают появляться после окончания инкубационного периода, который длится от 1-й до 3-х недель, и в это время болезнь не имеет проявлений.

Для кишечной формы острой стадии характерны:

  1. Боли в правом подреберье, в районе пупка и редко внизу живота.
  2. Отрыжка.
  3. Чувство тяжести в левой части живота.
  4. Снижение аппетита.
  5. Учащенный стул до 3-5 раз в сутки, который может смениться запором.
  6. Тошнота.
  7. Постоянное чувство тяжести в желудке.
  8. Метеоризм.
У детей раннего возраста наблюдается кашицеобразный стул. Длительность острой фазы болезни составляет 5-7 дней, после чего наступает либо выздоровление, либо переход инфекции в подострое хроническое течение.

Гепатобилиарный вариант лямблиоза у женщин и мужчин проявляется болевыми ощущениями в районе печени и расстройством пищеварения.

Кожные проявления могут быть самыми разными и включать в себя бледность, появление желтушного оттенка, сухости и шелушения, аллергическую мелкую сыпь. Во рту может развиться стоматит, а в уголках рта появляются заеды или трещинки.

Синдром интоксикации при лямблиозе зависит от того, какое количество цист попало в организм, а также от длительности и от тяжести болезни. Пациенты могут жаловаться на головные боли, головокружение, нарушение сна, снижение работоспособности, раздражительность, эмоциональную лабильность. У детей возможны тики, гиперкинезы, обмороки.

Диагностика

Анализ на лямблиоз – единственный достоверный способ выявить заболевание, так как оно часто протекает без симптомов и не имеет специфических проявлений.

Основной перечень анализов для диагностики лямблиоза включает в себя:

  • Антигенный тест на лямблии, для обнаружения их в кале методом ИХА (иммунохроматографический). Помогает выявить острую или хроническую формы лямблиоза, бессимптомных носителей, а также является эффективным методом оценки лечения.
  • Определение антител классов A, M, G (IgM, IgA, IgG) к лямблиям в крови методом ИФА (иммуноферментный анализ) для своевременного выявления заражения.
  • Экспресс-исследование кала на антигены к лямблиям, амебам, криптоспоридии, которое помогает диагностировать паразитарные заболевания, протекающие без ярких симптомов.
  • Микроскопический метод исследования кала на простейшие и яйца гельминтов.
  • Анализ кала на углеводы, который назначается при болезнях тонкого кишечника с подозрением на заражение лямблиями.
Все остальные анализы и исследования для лямблиоза считаются неспецифическими и назначаются по показаниям. Это могут быть анализы крови, мочи, гастроскопия или УЗИ органов брюшной полости.

Лечение

Лямблиоз требует комплексного лечения. Терапия неосложненных форм проводится амбулаторно. При подтверждении диагноза назначается один из противолямблиозных препаратов, который необходимо сочетать с приемом желчегонных средств, а также препаратами, улучшающими микрофлору кишечника.

Хроническое течение требует длительного комплексного лечения, которое будет включать в себя не только прием лекарств, но и диету при лямблиозе, которая ограничивает поступление в организм углеводов. Справиться с простейшими помогают этиотропные препараты, а иммунотерапия помогает повысить естественные защитные силы человека. Обязательно назначают желчегонные средства и пробиотики для восстановления микрофлоры кишечника.

Современная медицина в лечении лямблиоза предлагает некоторые клинические рекомендации. На первом этапе назначаются диетотерапия и разгрузочные дни, а также прием желчегонных, а при необходимости и антигистаминных препаратов.

На втором этапе пациент принимает специальные антипротозойные препараты, выписанные врачом. Для избавления от лямблий часто назначается не один, а два курса.

На третьем этапе используются поливитамины, энтеросорбенты, ферментные препараты, иммуностимуляторы, фитотерапия.

Профилактика

После выздоровления риск повторного заражения не снижается, да и рецидивы случаются часто. Для полного избавления от паразитов часто требуется повторный прием препаратов. Диспансерное наблюдение проводится на протяжении 3-6 месяцев с обязательным обследованием на паразитов.

Для предупреждения заражения лямблиозом следует не пить сырую воду даже из-под крана, соблюдать все санитарно-гигиенические правила, обязательно мыть руки перед едой и после посещения туалета, не употреблять в пищу немытые овощи, фрукты, ягоды.

Важно при первом же подозрении на заболевание обратиться к врачу и пройти все необходимые исследования для опровержения или подтверждения диагноза с дальнейшим обязательным лечением.

Лечение лямблиоза — PMC

При оценке клинической эффективности средств, применяемых против Giardia , трудно сравнивать исследования. Они различаются по методологии включения (была ли проведена рандомизация и было ли лечение слепым или открытым), изучаемой популяции (дети, взрослые, симптоматические и/или бессимптомные пациенты), показателям результатов (клиническая эффективность и/или отрицательный анализ стула) и продолжительности лечения. следовать за. Тем не менее, если рассматривать исследования в целом, можно сделать выводы и сделать выводы об относительной эффективности препаратов.

Классы агентов и клинические свойства

Нитроимидазолы.

Класс нитроимидазолов, используемых для лечения инфекции G. lamblia , включает метронидазол, тинидазол, орнидазол и секнидазол. Этот класс был открыт в 1955 г. и показал высокую эффективность против нескольких протозойных инфекций 240. Метронидазол [1-(β-гидроксиэтил)-2-метил-5-нитроимидазол; Flagyl] был определен как терапевтический против Trichomonas vaginalis и Entamoeba histolytica после его открытия в конце 1950-х годов 67, а в 1962 году Darbon et al.сообщили, что его можно использовать для лечения лямблиоза 57. С момента этого открытия клиницисты использовали метронидазол и другие нитроимидазолы в качестве основы для лечения лямблиоза.

Из нитроимидазолов наиболее тщательно изучен механизм уничтожения Giardia метронидазолом. Метронидазол использует анаэробные метаболические пути, присутствующие в Giardia . Лекарство проникает в трофозоит, и как только он оказывается внутри клетки, электронтранспортные белки ферредоксины от паразита отдают электроны нитрогруппе лекарственного средства 223, 238, 244.Лекарство «активируется» восстановлением этой нитрогруппы 223, 238, 240, и в результате этой реакции восстановления устанавливается градиент, способствующий внутриклеточному транспорту метронидазола. Восстановленный метронидазол служит терминальным акцептором электронов, который ковалентно связывается с макромолекулами ДНК 72, 177. Это приводит к повреждению ДНК в виде потери спиральной структуры, нарушению функции матрицы и обрыву цепи с последующей гибелью трофозоитов 95. В дополнение к этому эффект, метронидазол ингибирует дыхание трофозоитов 81, 189.Восстановительная активация метронидазола может также приводить к образованию токсичных радикалов, которые реагируют с основными клеточными компонентами 244. Нитроимидазолы могут меньше влиять на трофозоиты внутри кист, возможно, из-за плохого проникновения лекарства через стенку кисты 236. Резистентность к метронидазолу индуцируется у vitro 29. Это коррелирует со снижением активности пируват:ферредоксин оксидоредуктазы паразита, которая необходима для восстановительной активации нитроимидазолов 239, 247.

Метронидазол быстро и полностью всасывается после перорального приема и проникает в ткани организма и выделения, такие как слюна, грудное молоко , сперма и вагинальные выделения 240.Препарат метаболизируется в основном в печени и выводится с мочой 147.

Анализы in vitro на чувствительность к нитроимидазолу проводились с G. lamblia с 1980 г. 112. Используя микроскопическую оценку морфологии и подвижности паразита, Jokipii и Jokipii впервые продемонстрировали эффективность метронидазола и тинидазола 129. Впоследствии, морфология 13, 166, 175, ингибирование роста 56, 69, 94, 116, 160, 225, включение [ 3 H]тимидина 32, 117, 164, уничтожение сыворотки 114 , витальное исключение красителя 114, 235, ингибирование прилипания 21, 55, 79, 166, 192, метаболический анализ 228 и колориметрический анализ 133 использовались для измерения in vitro реакции препарата на многие терапевтические агенты.Однако, как показывает разнообразие используемых анализов, не существует стандарта для тестирования in vitro, что затрудняет сравнение результатов и применение результатов in vitro в клинических условиях.

Из нитроимидазолов тинидазол и метронидазол постоянно демонстрируют наибольшую активность in vitro; тинидазол обладает небольшим преимуществом 30, 32, 55, 101. Более высокозамещенные нитроимидазолы, такие как миконазол, клотримазол, итраконазол и кетоконазол, были разработаны из-за их противогрибковой активности и не являются эффективными средствами против G.lamblia 55. Чувствительность к нитроимидазолам может варьироваться в зависимости от штаммов и клонов G. lamblia , используемых в тестировании 29, 31, 79, 160.

В США метронидазол является единственным представителем класса нитроимидазолов, доступным для лечить лямблиоз; это также наиболее распространенный препарат, используемый для лечения во всем мире. Несмотря на его широкое и общепринятое использование против Giardia , Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США никогда не одобряло его для этого показания. В клинических испытаниях применяли дозирование два и три раза в день (обычно 250 мг/доза) в течение 5–10 дней и короткий курс (1–3 дня), однократную ежедневную терапию (2.0 или 2,4 г/доза) 261. При 5-10-дневном режиме лечения эффективность колеблется от 60 до 100 % у взрослых и детей, при этом медиана эффективности в обеих группах составляет 92 % (таблица) 20, 49, 68. , 91, 92, 100, 127, 132, 135, 150, 151, 191, 201, 202, 232, 256. В целом этот график хорошо переносится, с большинством побочных эффектов, связанных с желудочно-кишечными расстройствами и металлическим привкусом (таблица).

Таблица 1

Таблица 1

Эффективность препаратов Анти- Гиардиа У взрослой и детской инфекции A

10052 900.0–2,4 г, разовая доза 92-100
Препарат
Препарат Доза B Средняя эффективность (%) C Диапазон эффективности (%) )
Метронидазол 500-750 мг/день × 5-10 дней 88 60-95 70070
48 36–60
2,0–2,4 г, 4 раза в сутки × 2 дня 71 67–80
2,0–2,4 г, 4 раза в сутки. × 3 дня 93-100 93-100
15-22,5 мг / кг / день × 5-10 дней D 94 80-100
Tinidazole 300 мг / день × 7 дней 87 74–100
1,0–2.0 г, одна доза 92 86-100
50 мг / кг, одна доза d 91 80069 91 80-96
Ornidazole 1,0-2,0 г, одна доза 96-100 96-100
40-50 мг / кг, одна доза D 92-100
Secnidazole 2,0 г, одна доза 86-100
30 мг / кг, 1 или 2 дозы D 88-100 88-100
Quinacrine 300 мг / день × 5-7 дней 95-100
6-8 мг / кг / день × 5-10 дней d 92-95
Furazolidone 400 мг / день × 7-10 дней 80-85
8 мг / кг /день × 7–10 дней д 92 81–96
Albendazole 200-800 мг / день × 1-3 дней 24-81
200-400 мг / день × 5-7 дней 94-100
Paromomycin 10-50 мг / кг / день или 1500 мг / день × 5-10 дней 55-88 55-88
Bicitracin Zink 240 000 U / Day × 10 дней 95
95

Таблица 2

Рекомендуемое дозирование и неблагоприятное воздействие анти- Giardia препараты

F B
препарат взрослых доза для взрослых доза Pediatric DOSE неблагоприятные эффекты
Metronidazole A 250 мг т .я бы. × 5–7 дней 5 мг/кг 3 раза в день × 5-7 дней головная боль, головокружение, тошнота, металлический вкус, urticaria
5 5 дисульфирам-подобная реакция с алкоголем
5
редко: периферическая нейтропатия, уплощение зубца Т при длительном применении
Мутагенный/канцерогенный?
Tinidazole B 2 г, одна доза 50 мг / кг, одна доза (макс, 2 г) как для Metronidazole
Ornidazole C 2 г, одна доза 40–50 мг/кг, разовая доза (макс. 2 г) То же, что и метронидазол
Хинакрин c 100 мг t.я бы. × 5–7 дней 2 мг/кг 3 раза в день × 7 дней тошнота и рвота, головокружение, головная боль
5 5 5
5 5 редко: токсичный психоз
Furazolidone D 100 мг четыре раза в день × 7–10 дней 2 мг/кг 4 раза в день × 10 дней Тошнота, рвота, диарея
Коричневое окрашивание мочи; Диссульфирамная реакция с алкоголем алкоголя
реагирует неблагоприятно с ингибиторами МАО
180065
Мягкий гемолиз в дефиците G6PDH
5 канцероген?
Паромомицин a 500 мг t.я бы. × 5–10 дней 30 мг/кг/день в 3 приема × 5–10 дней Ототоксичность и нефротоксичность при системном введении
Альбендазол a 400 мг 4 раза в сутки × 5 дней 15 мг / кг / день × 5-7 дней (макс, 400 мг) анорексия, запор
5 5 редкость: обратимые нейтропения и повышенные испытания печени
5 Тератогенный?
Бацитрацин цинк e 120 000 U b.я бы. × 10 дней Не тестировалось у детей до 10 лет Тошнота, рвота, дискомфорт в животе
Нефротоксичность с системным всасыванием ежедневно) были разработаны для улучшения соблюдения режима без ущерба для эффективности. Их применяли как у взрослых, так и у детей. Эти схемы, как правило, менее эффективны, особенно если вводится только одна доза метронидазола.Эффективность однократной терапии колеблется от 36 до 60% при назначении препарата в течение 1 дня 16, 93, 127, 130, 220, 229 и повышается до 67–80% при назначении препарата в течение 2 дней (табл. ). 127, 130, 146; Э. Грин, Д. М. Линч, Дж. А. Макфадзин и И. М. Пью, Письмо, Бр. Мед. J. 2: 411–412, 1974). Продолжение однократной дозы в течение 3 дней увеличивает эффективность до уровня, наблюдаемого при более низких дозах и более длительном курсе терапии 229; Грин и др., письмо). Схемы с высокими дозами также могут иметь больше побочных эффектов 127.

Дети были включены во многие испытания как длительного, так и короткого курса терапии, с результатами, аналогичными таковым у взрослых, и эффективностью от 80 до 100% (медиана 94%) при 5-10-дневных схемах 91 , 100, 132, 135, 186, 201, 232; А. Растегар-Лари и А. Салек-Могхаддам, Письмо, J. Trop. Педиатр. 42: 184–185, 1996). Хотя метронидазол не выпускается в стандартной жидкой форме, суспензию можно приготовить путем тщательного измельчения таблеток метронидазола, использования капли глицерина в качестве смазки и суспендирования смеси в вишневом сиропе NF 150.

Наиболее распространенные побочные эффекты лечения метронидазолом включают головную боль, головокружение, тошноту и металлический привкус во рту (таблица). Тошнота возникает у 5-15% пациентов, получающих стандартные многодневные курсы 135, 151. Кроме того, метронидазолу приписывают панкреатит, токсическое воздействие на центральную нервную систему 144, 212 и транзиторную обратимую нейтропению 147. избегайте употребления алкоголя при приеме метронидазола. Ингибирование альдегиддегидрогеназы метронидазолом может вызвать сильную рвоту, приливы, головную боль и желудочно-кишечные боли после приема алкоголя.

Метронидазол оказывает мутагенное действие на бактерии и канцерогенное действие на мышей и крыс в высоких дозах в течение длительного времени 34, 153, 240, 251. Однако мутагенность у людей никогда не регистрировалась, что позволяет предположить, что использование метронидазола в этом отношении безопасно 23, 78, 98, 212. Это может, однако, смягчить воздействие коротких курсов высоких доз у детей.

Обнаружение терапевтической эффективности метронидазола побудило исследователей разработать и испытать другие производные нитроимидазола.Другие препараты, тинидазол, орнидазол и секнидазол, имеют более длительный период полувыведения, что делает их подходящими для однократной терапии суточными дозами 217. Одна доза тинидазола (Фазигин) была успешно использована в 1971 г. в группе шведских студентов, заболевших лямблиозом. во время визита в Россию 11. Эта однократная доза 2 г (или эквивалент для детей) последовательно доказывала клиническую эффективность от 80 до 100% со средней эффективностью 92% (таблица) 16, 126, 130, 131 , 146, 151, 193, 222, 229, 261; З. Фарид, Н.A. El Masry, W. F. Miner и A. Hassan, Letter, Lancet ii: 721, 1974; Т. Петтерссон, Письмо, Бр. Мед. J. 1: 395, 1975) и значительно превосходит метронидазол при прямом сравнении режимов однократного введения 93, 130, 229, 261. Также наблюдается улучшенное соблюдение этого режима дозирования. Рекомендуемая доза для детей обычно составляет 50 мг/кг для однократной дозы (таблица) 82, 193, 232, 256, и препарат доступен в виде жидкой суспензии.

Побочные эффекты тинидазола встречаются не так часто, как метронидазол, но включают горечь, головокружение и желудочно-кишечные расстройства (таблица) 130, 131; Петтерссон, письмо).Тинидазол недоступен в Соединенных Штатах, но поставщики медицинских услуг рекомендуют некоторым путешественникам, особенно путешествующим в течение длительного времени или путешествующим по суше в Азии, приобрести препарат по прибытии в страну назначения и принимать его в случае заражения лямблиозом 113.

Другим производным нитроимидазола, которое также недоступно в США, является орнидазол. Было проведено меньше исследований с орнидазолом, но он обладает превосходной эффективностью при приеме в течение нескольких дней и эффективностью, подобной тинидазолу (от 92 до 100%), при однократном приеме 19, 131, 145, 220, 232, 261.Однократная доза орнидазола (40 мг/кг) также назначалась детям с очевидными преимуществами в отношении соблюдения режима лечения и стоимости [39, 186]. рутинное использование этого препарата у детей до завершения широкомасштабных исследований рецидивов, канцерогенности и побочных эффектов 39.

Секнидазол, производное 5-нитроимидазола длительного действия, использовался, но недоступен в США.Подобно тинидазолу и орнидазолу, секнидазол обычно назначают однократно. Наиболее распространенная схема составляет 2 г для взрослых и 30 мг/кг для детей 95. Клинические исследования демонстрируют уровень эффективности более 85% при однократном приеме у взрослых 49; Р. Бакай, Х. Куреши и С. Дж. Зубери; Письмо, Дж. Пак. Мед. доц. 45:288, 1995), а у детей эта доза так же эффективна, как 7-10-дневный курс метронидазола 100; Растегар-Лари и Салек-Могаддам, Письмо). Препарат быстро и полностью всасывается, имеет период полувыведения от 17 до 29 часов и метаболизируется путем окисления в печени 95.Сообщалось о побочных эффектах, в первую очередь желудочно-кишечных расстройствах (тошнота, анорексия и боль в животе) и головокружении, но обычно не требующих отмены препарата.

Квинакрин.

Хинакрин (атабрин) был впервые представлен в качестве противомалярийного средства в 1930 году после работы Кикута и стал предпочтительным противомалярийным средством для союзных войск во время Второй мировой войны из-за его большей доступности и лучшей переносимости по сравнению с хинином 240. После войны, вскоре он стал важным агентом против G.lamblia с клинической эффективностью 90% и более 20, 52, 105, 255. Однако, поскольку рынок США ограничен лечением Giardia , использование хинакрина сократилось, и его производство в США было прекращено. в 1992 г., хотя его все еще можно получить из альтернативных источников (таблица).

Противопротозойный механизм хинакрина до конца не выяснен. Препарат легко встраивается в ДНК G. lamblia , и считается, что именно это взаимодействие вызывает ингибирование синтеза нуклеиновых кислот 240.Различная относительная скорость поглощения хинакрина между человеческими и клетками G. lamblia может быть причиной селективной токсичности препарата 236. в одном исследовании это коррелировало со снижением усвоения препарата 246. Квинакрин быстро всасывается из кишечного тракта и широко распределяется в тканях организма.

Хотя результаты различаются в зависимости от используемого теста чувствительности in vitro, было показано, что метронидазол и фуразолидон немного более эффективны, чем хинакрин 30, 32, 55, 94.Однако в других исследованиях in vitro эффективность хинакрина и метронидазола одинакова 21, 117, 164. Некоторые из этих различий могут быть связаны с большей вариабельностью чувствительности к хинакрину, чем к метронидазолу или фуразолидону между клонами Giardia 31.

Клинически хинакрин очень эффективен: исследования показали, что его эффективность в течение 5-10 дней составляет около 95% (таблица) 20, 135, 220, 255. Некоторые исследователи считают этот препарат наиболее эффективным из всех анти- Giardia терапевтические средства 256.Дозировка обычно составляет 100 мг три раза в день в течение 5–7 дней для взрослых и 6 мг/кг/день в три приема в течение 5–7 дней для детей (таблица) 150.

Побочные эффекты не позволяют многим врачам использовать хинакрин. , особенно у детей (таблица). Горький вкус наряду с рвотой отмечался у 28% участников исследования 20, 52 и приводил к более низкой эффективности у детей младше 5 лет 52, вероятно, из-за низкой приверженности лечению. Желто-оранжевое обесцвечивание кожи, склер и мочи наблюдается у 4-5% пациентов, принимающих хинакрин, начиная примерно через 1 неделю после начала лечения и может сохраняться до 4 месяцев после прекращения терапии.Другие распространенные побочные эффекты включают тошноту, рвоту, головную боль и головокружение 254. Лекарственный психоз встречается редко, а эксфолиативный дерматит и ретинопатия, вызванная хинакрином, встречаются редко 82. Хинакрин может усугублять псориаз, а глюкозо-6-фосфатдегидрогеназа (Г6ФДГ) может усугублять течение псориаза. -дефицитные люди, это может вызвать гемолиз. Противопоказан при беременности из-за возможной связи с расщеплением позвоночника и агенезией почек. Никогда не было доказано, что он канцерогенен, хотя он имеет механизм действия связывания с ДНК.

Фуразолидон.

Фуразолидон (фуроксон) является одним из тысяч нитрофурановых соединений, созданных с момента открытия этого класса в 1940-х годах143. Он эффективен против многих бактерий, включая Campylobacter spp. и Staphylococcus aureus . Еще в 1950-х годах фуразолидон использовался для лечения лямблиоза 253. Он одобрен для использования в Соединенных Штатах и ​​остается важным терапевтическим средством во всем мире.Из распространенных терапевтических средств против Giardia это единственное, доступное в США в виде жидкой суспензии; поэтому его использование было рекомендовано в педиатрической популяции 150.

Механизм действия фуразолидона против G. lamblia , как и многих противопаразитарных средств, полностью не объяснен. Препарат подвергается восстановительной активации в трофозоите G. lamblia , но, в отличие от метронидазола, восстановление, возможно, происходит с помощью НАДН-оксидазы 38, 244.Его убивающий эффект коррелирует с токсичностью восстановленных продуктов, которые могут повредить важные клеточные компоненты, включая ДНК. Резистентность к фуразолидону может быть связана с уменьшением проникновения лекарственного средства 246 или с повышенным уровнем тиол-циклирующих ферментов, которые могут защищать от токсичных радикалов 249. Лекарственное средство легко всасывается через желудочно-кишечный тракт и быстро метаболизируется в тканях, что приводит к низким концентрациям в сыворотке и моче 143.

В тестах на чувствительность in vitro фуразолидон действует сравнимо с метронидазолом и постоянно демонстрирует самую высокую активность среди неимидазолов 32, 55, 101; он более активен, чем хинакрин 30.

Клинические исследования с использованием фуразолидона многочисленны и были завершены с широким кругом субъектов, доз и графиков введения. Хотя его эффективность обычно считается несколько ниже, чем у метронидазола и хинакрина, сообщалось о показателях излечения от 80 до 96% при 7-10-дневных курсах (таблица) 20, 52, 91, 151, 178, 191. , 201, 255. Когда препарат принимается всего 5 дней, его эффективность значительно падает 151, 178. Его назначают в виде четырех доз в день как взрослым (100 мг на дозу), так и детям (1.5 мг/кг) (таблица). В педиатрической суспензии две столовые ложки заменяют таблетку по 100 мг.

Около 10% пациентов сообщают о желудочно-кишечных симптомах, таких как тошнота, рвота и диарея (таблица) 150, 256. Другие побочные эффекты могут включать изменение цвета мочи на коричневый; гемолиз может возникать у пациентов с дефицитом G6PDH. Препарат оказывает ингибирующее действие на моноаминоксидазу (МАО), и его никогда не следует назначать одновременно лицам, уже принимающим ингибиторы МАО. Были редкие сообщения о дисульфирамоподобных реакциях при приеме с алкоголем 164b.Сообщалось о маниакальном эпизоде, вызванном фуразолидоном, у пациента, инфицированного вирусом иммунодефицита человека 73. Фуразолидон также противопоказан детям в возрасте до 1 месяца, у которых может развиться гемолитическая анемия из-за обычно нестабильного глутатиона. Наконец, препарат оказывает мутагенное действие на бактерии и, как было показано, вызывает опухоли молочных желез у крыс и опухоли легких у мышей при длительном приеме в высоких дозах. Однако значение этого открытия для человека неизвестно и не было адекватно рассмотрено 143, 164b, 236.При лечении детей преимущества минимальных побочных эффектов и доступности жидкой суспензии необходимо сопоставлять с необходимостью частого введения в течение 10-дневного периода лечения.

Бензимидазолы.

Два представителя класса бензимидазолов, альбендазол (Albenza) и мебендазол (Vermox), использовались для лечения инфекции G. lamblia 155. Клинические исследования и исследования эффективности in vitro дали разные результаты в отношении их эффективности.Однако сравнительно мягкий профиль побочных эффектов в сочетании с доказанной эффективностью против многих гельминтов делает их перспективными для лечения 208, 250. -тубулиновый цитоскелет 71, 175, 209. Это связывание вызывает как ингибирование полимеризации цитоскелета, так и нарушение захвата глюкозы 250. Хотя точное место связывания на цитоскелете не определено, постулируется, что взаимодействие бензимидазол-колхицин может играть определенную роль. 51, 166, 236.Бензимидазолы плохо всасываются из желудочно-кишечного тракта, хотя это можно улучшить при одновременном приеме жирной пищи. Системный эффект альбендазола обусловлен его первичным метаболитом, альбендазолсульфоксидом, который быстро образуется в печени после абсорбции 3. Выведение почками незначительно.

Тестирование in vitro чувствительности G. lamblia к бензимидазолам ограничено по сравнению с чувствительностью паразита к нитроимидазолам или хинакрину.Тем не менее, исследования демонстрируют значительный эффект in vitro 79, 175, 208, 209. В одном отчете показано, что и альбендазол, и мебендазол были в 30-50 раз более активны, чем метронидазол, и в 4-40 раз более активны, чем хинакрин in vitro 71. Другой продемонстрировал, что способность альбендазола влиять на морфологию, прилипание и жизнеспособность трофозоитов была намного выше, чем у метронидазола или тинидазола 166. Однако их переменная клиническая эффективность демонстрирует несоответствие между тестированием in vitro и активностью in vivo.Резистентность к альбендазолу может быть индуцирована in vitro 154 и коррелирует с изменениями в цитоскелете паразита 243. Другие бензимидазолы, такие как нокодазол, оксфендазол, тиабендазол и фенбендазол, также продемонстрировали некоторую эффективность in vitro 236.

Клинические испытания ограничивались альбендазолом и мебендазол со смешанными результатами. Холл и Нахар сообщили о равной лечебной эффективности альбендазола и метронидазола у детей, когда альбендазол назначался в течение 5 дней, но не при однократном или трехдневном приеме (таблица) 104.Снижение эффективности альбендазола при приеме в течение 3 дней или менее также было задокументировано Kollaritsch et al. у путешественников с лямблиозом 137, Pungpak et al. у детей и взрослых 198, и Pengsaa et al. у детей 193. Повышение эффективности наблюдалось у других пациентов, когда препарат назначался в течение 5 дней 171, 207, 214 или 7 дней 198. Исключение в отношении необходимости более длительных курсов лечения наблюдалось в одном исследовании, в котором вводилась однократная доза 68. Комбинация альбендазол-метронидазол была эффективна на 100% у 20 пациентов с резистентным к метронидазолу лямблиозом, у которых три-пять курсов стандартной пероральной терапии метронидазолом оказались неэффективными 44.

Лечение мебендазолом привело к сильно различающимся клиническим результатам. Al-Waili сообщил о более чем 90% эффективности в двух исследованиях у детей 8, 9. Однако другие исследования как у детей, так и у взрослых не показали одинакового успеха, но вместо этого показали эффективность у 80% 211 и у 60% или менее 39, 92 , 132; Л. ди Мартино, А. Ночерино и М. Петтоелло Мантовани, Письмо, пер. Р. Соц. Троп. Мед. Гиг. 85: 557–558, 1991), а также отсутствие снижения показателей распространенности Giardia при использовании мебендазола при массовом лечении гельминтов 219.Из-за этого несоответствия наибольший интерес был сосредоточен на альбендазоле.

Дозировка для взрослых обычно составляет 400 мг в день в течение 5 дней для альбендазола и 200–400 мг в день в течение 5–10 дней для мебендазола (таблица). Обычная доза для детей составляет 15 мг/кг в сутки в течение 5–7 дней. Оба препарата доступны в виде суспензии. Одним из преимуществ использования альбендазола у детей является его эффективность против многих гельминтов, что позволяет эффективно лечить множество кишечных паразитов 207, 208. Другим преимуществом является относительное отсутствие побочных эффектов.Однако при кратковременном употреблении он может вызвать желудочно-кишечные проблемы, такие как анорексия и запор. Длительное применение альбендазола в высоких дозах, например, при личиночных цестодных инфекциях, вызывает обратимую нейтропению и повышение уровня печеночных ферментов [3, 155, 258]. Альбендазол противопоказан при беременности из-за возможного тератогенного действия (категория беременности). C), но исследования на животных не показали увеличения канцерогенной заболеваемости.

Паромомицин.

Паромомицин (хуматин), член семейства аминогликозидов, был впервые выделен в 1956 году.Он показан для лечения Entamoeba histolytica и Trichomonas и был предложен для лечения G. lamblia при резистентных инфекциях и во время беременности 113, 140. Паромомицин плохо всасывается из просвета кишечника; даже при пероральном введении больших доз достигаются лишь минимальные концентрации в крови и моче пациентов с нормальной функцией почек 140. Паромомицин ингибирует синтез белка G. lamblia , вмешиваясь в 50S и 30S рибосомные субъединицы (рРНК паразита имеет необычный размер и последовательность) и вызывая неправильное прочтение кодонов мРНК 69.

Анализ чувствительности in vitro показывает, что паромомицин обладает активностью в отношении G. lamblia , но в целом активность ниже, чем у нитроимидазолов, хинакрина или фуразолидона 30, 101. Однако из-за плохой кишечной абсорбции он компенсирует его низкая противопротозойная активность за счет достижения высокого уровня в кишечнике. В модели на крысах препарат показал эффективность 15.

Клинические исследования ограничены, терапевтическая эффективность колеблется от 55 до почти 90% (таблица) 47, 63, 140, 191, 218.Обычная доза составляет 500 мг три раза в день в течение 10 дней для взрослых и 25-30 мг/кг/день (разделенная на три приема) для детей (таблица).

Как и другие аминогликозиды, при системном всасывании паромомицин может вызывать ототоксичность и нефротоксичность. Однако он может быть менее ототоксичен, чем другие аминогликозиды 142, и с ограниченной системной абсорбцией токсичность не должна вызывать беспокойства у людей с нормальными почками. Тем не менее, его следует использовать с осторожностью у пациентов с нарушением функции почек.

Бацитрацин цинк.

Поиск альтернативных эффективных препаратов против Giardia привел исследователей к рассмотрению вопроса о бацитрацине. Бацитрацин был впервые выделен в 1945 г. из штамма Bacillus и применялся системно против тяжелых стафилококковых инфекций до 1960 г., когда его токсичность и доступность других антибиотиков ограничили его главным образом местным применением 141. Цинк был добавлен в комплекс бацитрацина для стимулирования стабильность. Бацитрацин оказывает свое действие на бактерии, препятствуя стадии дефосфорилирования в синтезе клеточной мембраны.После продемонстрированной in vitro эффективности против E. histolytica и Trichomonas , бацитрацин цинка был протестирован in vitro против Giardia и оказался активным 12, 13.

Клиническое исследование, проведенное Andrews et al. использовали два раза в день в течение 10 дней и сравнили эффективность 120 000 ЕД бацитрацина цинка, 120 000 ЕД бацитрацина, 120 000 ЕД неомицина и 60 000 ЕД бацитрацина цинка в сочетании с 60 000 ЕД неомицина 14. Частота излечения 95% для бацитрацин цинка, 88% для бацитрацина или комбинации бацитрацин цинк-неомицин и 86% для неомицина.Побочные эффекты были ограничены небольшим числом пациентов, которые испытывали диарею, дискомфорт в животе, запор и тошноту. Из исследования исключались дети младше 10 лет.

Недостатки использования бацитрацина цинка включают возможность нефротоксичности при длительном пероральном приеме и желудочно-кишечные расстройства. Кроме того, на соблюдение может повлиять 10-дневный период дозирования, а составы, используемые Эндрюсом в их исследовании, недоступны. Хотя бацитрацин цинка является многообещающим, необходимы дополнительные исследования, прежде чем он сможет получить широкое признание в качестве агента против G.лямблии .

Новые и экспериментальные терапевтические средства.

Широкий спектр химиотерапевтических агентов, включая рифампицин, битионол, дихлорофен, гексахлорофен, пириметамин, фузидат натрия, хлорохин и мефлохин, продемонстрировал активность in vitro в отношении Giardia 81, 84, 233. Липофильные тетрациклины, такие как доксициклин, сильно активен in vitro; однако их клиническая эффективность ограничена, возможно, из-за их быстрой абсорбции из кишечника 70.Некоторые аналоги пентамидина, а также азитромицин обладают активностью in vitro, сравнимой с активностью метронидазола 25, 33.

Нитазоксанид, производное 5-нитротиазола с широким спектром активности против простейших, гельминтов и некоторых бактерий, показал ограниченную эффективность у взрослых. и у детей в Мексике (эффективность 71% [213] и 78% [211] соответственно) и у нескольких больных СПИДом в Мали 64. Его назначали в дозе от 100 до 500 мг два раза в день в течение 3-7 дней.

Исследования на крысиной модели продемонстрировали эффективность ивермектина в определенных условиях 260.Дисульфирам, активное цинковое соединение, используемое для лечения алкоголизма у людей, показывает значительную частоту излечения и снижение паразитарной нагрузки на мышиной модели лямблиоза 180.

у племен луо в Восточной Африке метанольные экстракты 21 из 36 исследованных таксонов были летальными или подавляли рост G. lamblia in vitro 124. Экстракты Geranium nivem также показали активность in vitro 45.Иммуномодулирующий растительный препарат Pippali rasayana , часто назначаемый для лечения гельминтозов и хронической дизентерии в Индии, достиг 98% излечения мышиной инфекции с помощью G. lamblia 6. Экстракты плодов Piper longum были эффективны при мышиная модель инфекции 241.

Proposlina, препарат пчелиного клея, продемонстрировал 60% уровень паразитологического излечения через 1 неделю после завершения лечения среди 48 взрослых на Кубе 172, 261. У пациента с резистентной к метронидазолу инфекции Giardia Антагонист β-адренорецепторов dl-пропранолол, назначаемый в дозе 40 мг три раза в день с метронидазолом по 400 мг три раза в день в течение 10 дней, излечил инфекцию, продемонстрировав клиническую эффективность у человека 197.Исследования in vitro демонстрируют, что пропранолол оказывает свое действие, подавляя подвижность и рост простейших, скорее всего, благодаря мембраностабилизирующей активности препарата 85. Однако необходимы дальнейшие исследования dl-пропранолола и родственного соединения d-пропранолола. прежде чем их можно будет рекомендовать в качестве средств против Giardia .

Иммунопрофилактические стратегии для предотвращения или лечения лямблиоза, как правило, не были эффективными 87. Пассивный перенос иммунной сыворотки против Giardia не способствовал элиминации паразитов при лямблиозе мышей 76, 242.Несмотря на то, что пациенты с общим вариабельным иммунодефицитом имеют симптоматическую и длительную инфекцию Giardia , противопаразитарная терапия необходима для контроля их инфекции 106, 216. липазы, стимулируемой солями желчных кислот 204. Кроме того, грудное вскармливание может оказывать некоторую защиту грудным детям 176, 183; однако метод введения энтеральных антител против Giardia не изучался.

Особые ситуации

Беременность и кормление грудью.

Ведение симптоматической инфекции G. lamblia во время беременности является сложной задачей для клинициста, поскольку ни один терапевтический агент не сочетает в себе оптимальную эффективность и безопасность. Женщинам с бессимптомным течением, легкой формой заболевания или в первом триместре обычно следует избегать лечения. Однако женщинам, у которых невозможно поддерживать адекватную гидратацию и нутриционный статус, следует проводить лечение даже в первом триместре.

Метронидазол, который быстро попадает в кровоток плода после поглощения матерью, продемонстрировал мутагенность в отношении бактерий и канцерогенность в отношении мышей и крыс 34, 36, 153, 240, 251. Хотя эта информация вызывает обеспокоенность по поводу использования препарата во время беременности , канцерогенность не была продемонстрирована у людей 23, 24, 78, 98, 212, а также не было тератогенности у грызунов 164a. Метронидазол широко применялся во время беременности (категория беременности В), прежде всего для лечения трихомониаза курсами от 7 до 10 дней [42].Результаты относительно безопасности для плода противоречивы 36, 42, 107, 212, 215, 218. В одном ретроспективном исследовании 1469 женщин, принимавших метронидазол во время беременности, 206 из которых принимали препарат в первом триместре, не было обнаружено признаков врожденных аномалий 26. Тем не менее, Совместный перинатальный проект, включавший более 50 000 пар мать-ребенок, продемонстрировал, что воздействие метронидазола в первом триместре у 31 женщины показало возможную связь с пороками развития 107. Мета-анализ семи исследований, в которых проспективно наблюдали 253 пары мать-ребенок. и ретроспективный мониторинг 1083 пар не выявил повышенного риска пороков развития плода в связи с использованием метронидазола в первом триместре 42, при этом в одном отчете относительный риск оценивается как 0.92 для врожденных дефектов 215. В целом, может быть несколько повышенный риск при использовании метронидазола в течение первого триместра, поэтому его следует избегать в этот период. Короткие курсы высоких доз (≥2,0 г) не следует назначать во время беременности.

Метронидазол активно выделяется с грудным молоком в концентрациях, сходных с таковыми в плазме. Американская академия педиатрии (AAP) рекомендует однократно давать 2 г кормящим матерям с последующим прекращением кормления на 12–24 ч [10, 36].ААР также рекомендует матерям, принимающим тинидазол, прекратить кормление грудью на тот же период времени, что и тем, кто принимает метронидазол 10. Однако метронидазол одобрен для использования у детей для лечения амебиаза и используется у детей для лечения анаэробных инфекций, поэтому может показаться, что небольшое количество, выделяемое в грудное молоко, не будет вредным. Кроме того, поскольку однократные схемы метронидазола с высокими дозами имеют низкую эффективность и, как ожидается, приведут к более высоким уровням в грудном молоке, эти данные свидетельствуют в пользу традиционного лечения более низкими дозами в течение 5–7 дней.

Паромомицин обычно считается безопасным, поскольку он плохо всасывается из кишечника и почти на 100% выводится с калом в неизмененном виде. Поэтому мало, если вообще какое-либо лекарство достигнет плода. Однако он не так эффективен, как метронидазол или акрихин. Кроме того, никакие клинические испытания не изучали влияние высоких концентраций паромомицина в сыворотке крови во время беременности. Тем не менее, паромомицин успешно применялся для эрадикации инфекции G. lamblia у беременных женщин и является важным средством, которое следует рассмотреть в течение первого триместра, когда не следует использовать метронидазол 140, 218.Паромомицин также должен быть безопасным для кормящих матерей. Исследование на овцах показало, что скорость выделения препарата в грудном молоке составляет всего 0,018% в течение 12 часов после парентерального введения 36, 263. ААП определяет, что стрептомицин и канамицин, аминогликозидные родственники паромомицина, совместимы с грудным вскармливанием 10.

Один эксперт по лямблиозу поддержал лечение беременных хинакрином из-за его высокой степени излечения 256. Хотя препарат очень эффективен, его медленное выведение из организма и доказанная тератогенность на крысах делают его неоптимальным выбором для лечения беременных.Хотя хинидин и хинин совместимы с грудным вскармливанием, информации о безопасности хинакрина для детей, находящихся на грудном вскармливании, не имеется 10.

Фуразолидон не рекомендуется беременным. Хотя он эффективен, он вызывает опухоли молочных желез у мышей и мутации бактерий, что должно удерживать врачей от его использования в этих условиях 164b. Его безопасность для детей, находящихся на грудном вскармливании, неизвестна. Альбендазол считается препаратом категории С при беременности и оказывает тератогенное действие на крыс и кроликов, хотя опыт его воздействия на беременных женщин невелик.

Бессимптомная инфекция.

В глобальном масштабе у большинства людей, инфицированных G. lamblia , заболевание протекает бессимптомно или с минимальными симптомами. Лечение бессимптомных пациентов, особенно детей, является спорным вопросом, и перед началом терапии необходимо учитывать несколько факторов. Обстановка инфекции играет ключевую роль в принятии решения. В районах, где G. lamblia является эндемичным, лечение может быть нежелательным, поскольку после лечения дети могут быстро заразиться повторно 96, 231.Если Giardia способствует отсутствию роста и развития 86, 163, 227, лечение, даже если может произойти повторное заражение, может обеспечить догоняющий рост 103 и может стоить затрат и усилий. В этих условиях может быть полезен такой препарат, как альбендазол, который также лечит нематодные инфекции; однако требование 5-дневного дозирования затруднило бы завершение терапии во многих ситуациях.

В условиях, при которых базовый уровень питания ребенка превосходен, например, в детских садах в развитых странах, бессимптомным носителям не всегда может потребоваться терапия 5, 121, 195, 203, 221, 237.Однако следует отметить, что бессимптомно инфицированные дети могут выделять Giardia в течение 195 месяцев, нести его домой членам семьи и, таким образом, инициировать заражение в домашнем хозяйстве и даже способствовать поддержанию высокого уровня инфекции Giardia в сообществе 4, 196, 224; GD Overturf, Editorial, Clin. Заразить. Дис. 18: 764–765, 1994). Нередко у матери маленького ребенка, находящегося в дневном стационаре, появляются симптомы лямблиоза, определяя наличие в домашнем хозяйстве Giardia , который был занесен бессимптомным ребенком.При рецидивирующей диарее, связанной с Giardia , в дневном стационаре, которую нельзя контролировать с помощью улучшения гигиены, лечения и исключения детей с симптомами, можно рассмотреть вопрос о скрининге и лечении всех детей в дневном стационаре 5, 18. , 230.

При обнаружении Giardia в стуле и маловероятности повторного заражения, например, у вернувшегося путешественника, можно назначить лечение. В домашнем хозяйстве, если у одного члена есть симптомы и существует вероятность фекально-орального распространения внутри семьи или наличия общего источника инфекции, все члены семьи должны пройти обследование и лечение, чтобы не произошло повторного заражения.

Другим фактором, который следует учитывать при принятии решения о лечении бессимптомных носителей, являются последствия передачи инфекции, если носитель не лечится, например, заражение работников пищевых продуктов 169, 199. Эту группу следует лечить, чтобы предотвратить вспышки пищевого происхождения.

Резистентность и рецидив.

Сообщалось о неэффективности лечения всеми распространенными препаратами против Giardia , включая метронидазол, хинакрин, фуразолидон и альбендазол. Тем не менее, для клинициста, сталкивающегося с рецидивом симптомов после терапии, важно различать действительную лекарственную устойчивость, излечение с последующим повторным инфицированием и пост- Giardia непереносимость лактозы.Таким образом, первым шагом является документирование истинной персистирующей инфекции путем отправки образца стула на исследование O&P или обнаружение антигена Giardia . Если проба положительна, тщательный анамнез контакта должен предоставить информацию о вероятности повторного заражения, а повторно инфицированные лица должны реагировать на первоначальное терапевтическое средство. Повторное заражение будет обычным явлением в эндемичных регионах мира и в условиях плохой фекально-оральной гигиены. Если у пациента произошло повторное инфицирование, следует выявить факторы риска и проконсультировать пациента относительно правильных мер гигиены и профилактики.

Непереносимость лактозы после введения Giardia является наиболее частым дефицитом дисахаридазы, связанным с лямблиозом, и может возникать у 20–40% пациентов 65. должны быть установлены продукты питания и жидкости. Этот синдром может занять несколько недель, чтобы решить.

Истинная неудача лечения может означать заражение лекарственно-устойчивым изолятом Giardia . Резистентность к большинству агентов против Giardia была задокументирована или индуцирована in vitro 29, 154, 245–247, а также к множеству генотипически различных клонов G.lamblia с чувствительностью к различным классам препаратов были обнаружены в двенадцатиперстной кишке человека 46, 81, 160, 248. Однако не было выявлено последовательной корреляции между резистентностью или чувствительностью in vitro и клинической неудачей или успехом 43, 160, 164, 225, 249, по-прежнему оставляя открытым вопрос об истинной резистентности к паразитам.

Клинически резистентные штаммы лечили более длительными повторными курсами или более высокими дозами исходного агента 91, 165, 178. Однако наиболее эффективным средством искоренения этих инфекций, по-видимому, является использование препарата другого класса, чтобы избежать потенциального перекрестного заражения. сопротивление 52, 92.Первоначальный переход на препарат другого класса не всегда может быть эффективным, как это было продемонстрировано у двух французских пациентов, у которых лечение альбендазолом было неудачным после двух курсов метронидазола, но был ответ на хинакрин (P. Brasseur and L. Favennec, Letter, Parasite 2: 422, 1995). Комбинированные режимы с использованием метронидазола-альбендазола, метронидазола-хинакрина или других активных препаратов или назначение нитроимидазола плюс хинакрина курсом не менее 2 недель доказали свою эффективность при рефрактерной инфекции 44, 182a, 197, 225, 234.Иногда для эффективного лечения потребуются несколько различных комбинаций или подходов.

В случаях лямблиоза, при котором альтернативная терапия неэффективна, следует рассмотреть другие возможности, такие как наличие иммунологической недостаточности. Хронический лямблиоз у пациентов с гипогаммаглобулинемией хорошо регистрируется 106, 108, 216 и может быть трудно поддающимся лечению, часто требующим длительных курсов терапии. Хотя Giardia наблюдается у гомосексуальных мужчин, занимающихся орально-анальным сексом 162, 200, 226, болезнь часто может быть ни тяжелой, ни продолжительной 148.Тем не менее, у больных СПИДом с тяжелым лямблиозом может потребоваться пролонгированная или комбинированная терапия 182a.

Что это такое, симптомы, лечение, причины

Обзор

Что такое

Giardia ?

Giardia кишечная — это микроскопический паразит (слишком маленький, чтобы увидеть его невооруженным глазом). Он может поражать людей и животных, таких как собаки, кошки и дикие животные. Паразит — это организм, которому для выживания нужен другой организм (например, человек или животное).

Что такое лямблиоз?

Лямблиоз (JEE-are-die-uh-sis) инфекция, вызываемая паразитом Giardia . После того, как кто-то вступает в контакт с паразитом, паразит может жить в его кишечнике. Это может сделать вас больным.

Насколько распространен лямблиоз?

Giardia Паразиты живут по всему миру, в большинстве стран и континентов. Это, как правило, более серьезная проблема в странах с плохой санитарией, таких как развивающиеся страны. Но получить его можно практически везде.

В США лямблиоз является наиболее распространенной паразитарной инфекцией, поражающей кишечник.

Симптомы и причины

Что вызывает лямблиоз?

Лямблиоз вызывается паразитом Giardia кишечная .

Как передается лямблиоз?

Лямблиоз может передаваться через пищу или воду. Он также распространяется через поверхности, зараженные цистами Giardia , или через твердые оболочки, содержащие паразита. Несмотря на то, что для выживания паразитам нужен хозяин (другое живое существо), оболочка Giardia позволяет паразиту жить самостоятельно в течение продолжительных периодов времени.

Люди обычно заражаются лямблиозом при проглатывании паразита с неочищенной водой. Лямблиоз распространяется даже в следовых количествах зараженного стула (фекалий) — в количествах настолько малых, что вы их не видите. Если у вас лямблиоз, вы можете заразить кого-то еще, даже если у вас нет симптомов.

Заразиться лямблиозом можно через:

  • Питьевая вода из неочищенных источников воды (таких как озера, ручьи или бассейны).
  • Поездки в страны с плохой санитарией.
  • Тесное сотрудничество с маленькими детьми (например, в детском саду).
  • Проглатывание паразита после прикосновения к поверхности (например, к дверной ручке или игрушке), загрязненной небольшим количеством инфицированных фекалий.
  • Занятие сексом, особенно анальным сексом, с инфицированным человеком.

Кто болеет лямблиозом?

Каждый может заболеть лямблиозом. Нахождение в местах, где фекалии могут легко распространяться (например, в центрах, где много маленьких детей), может увеличить ваши шансы заразиться.Люди часто заражаются лямблиозом после питья из реки или ручья во время кемпинга или похода. Вот почему лямблиоз иногда называют бобровой лихорадкой.

Могут ли животные болеть лямблиозом?

Животные могут заболеть лямблиозом и передать его другим животным. Но паразит Giardia , от которого заболевают люди, отличается от паразита, поражающего животных. Таким образом, вы вряд ли заразитесь лямблиозом от своего питомца или дикого животного.

Что делает лямблиоз?

Когда паразит Giardia попадает в ваше тело, он живет в тонкой кишке.Это может вызвать боль в животе. Не каждый, кто вступает в контакт с Giardia , заболевает. Если вы заболеете, инфекция может пройти сама по себе.

Каковы симптомы лямблиоза?

Лямблиоз обычно вызывает пищеварительные симптомы, такие как диарея или желудочные спазмы. Симптомы могут быть слегка раздражающими или тяжелыми. У некоторых людей симптомы отсутствуют.

Симптомы лямблиоза включают:

  • Диарея (водянистый или жирный стул).
  • Усталость (чувство чрезмерной усталости в течение длительного времени).
  • Беспокойный желудок или тошнота.
  • Спазмы желудка.
  • Вздутие живота или газы.
  • Обезвоживание, которое может привести к потере веса.

Когда появляются симптомы лямблиоза?

Если у вас лямблиоз, вы можете заболеть через несколько дней после заражения. Пищеварительные симптомы могут длиться от двух до шести недель.

Симптомы могут проявиться через три недели после первого контакта. Возможно, от лямблиоза вообще не будет никаких симптомов.

Диагностика и тесты

Как диагностируется лямблиоз?

Поставщики медицинских услуг могут диагностировать лямблиоз, проверяя ваш стул на наличие паразита Giardia . Паразит может не обнаруживаться в каждом образце стула. По этой причине вашему врачу может потребоваться более одного образца для подтверждения диагноза.

Если у вас серьезные симптомы, врач может осмотреть кишечник с помощью тонкой гибкой трубки. Эта процедура называется верхней эндоскопией. Паразиты часто обнаруживаются при лабораторном окрашивании крошечных кусочков биоптата, полученного во время эндоскопии.Ваш поставщик может также взять образец содержимого вашего кишечника для поиска паразитов.

Управление и лечение

Как лечится лямблиоз?

Многие люди с лямблиозом имеют незначительные симптомы, которые проходят сами по себе. Вам может не понадобиться лечение.

Если у вас более серьезные симптомы паразитарного заболевания, ваш лечащий врач может назначить антибиотик с противопаразитарным эффектом для уничтожения паразита. Лекарства Giardia включают:

  • Метронидазол (Флагил®).
  • Тинидазол (Тиндамакс®).
  • Нитазоксанид (Алиния®).

Важно следовать инструкциям вашего врача и принимать каждую таблетку в соответствии с предписаниями. В противном случае вы можете не избавиться от инфекции и вам может потребоваться второй курс лечения, чтобы полностью избавиться от паразита. В редких случаях у некоторых пациентов развивается затяжная или рецидивирующая инфекция, которая требует обследования на предмет нарушений иммунной системы и помощи специалиста по инфекционным заболеваниям для составления комбинации препаратов, которая может помочь излечить инфекцию.

Профилактика

Можно ли предотвратить лямблиоз?

Giardia Паразиты микроскопические (слишком маленькие, чтобы их можно было увидеть без микроскопа). Трудно избежать того, чего не видишь. Но есть несколько способов минимизировать риск заражения лямблиозом.

Часто мойте руки.

Часто мойте руки с мылом и чистой проточной водой не менее 20 секунд. Всегда мойте руки:

  • До и после еды.
  • После посещения туалета.
  • После контакта со своими или чужими микробами (например, при смене подгузника).

Пейте только из безопасных источников воды.

Вода может содержать паразитов, даже если она выглядит чистой. Не пейте неочищенную воду, например, из колодцев, бассейнов, озер или рек. Если вас беспокоит загрязнение воды, не пейте ее. Если вы сомневаетесь, выберите воду в бутылках, если она доступна. Или кипятите воду в течение пяти минут, чтобы убить паразитов.

Знать основы безопасности пищевых продуктов.

Мытье всех фруктов и овощей под горячей водой может предотвратить лямблиоз. Не ешьте сырое или недоваренное мясо. Будьте особенно осторожны в странах, где вода и продукты питания могут быть заражены.

Практикуйте безопасный секс.

Практика безопасного секса может предотвратить широкий спектр заболеваний, передающихся половым путем. Для профилактики лямблиоза используйте средства защиты во время орально-анального секса и мойте руки сразу после секса.Эти методы могут гарантировать, что вы не вступите в контакт с инфицированными фекалиями.

Перспективы/прогноз

Каков прогноз (перспективы) для людей с лямблиозом?

Большинство людей с лямблиозом полностью выздоравливают в течение двух месяцев после появления легких или умеренных симптомов пищеварения. У некоторых людей симптомы со стороны желудочно-кишечного тракта (например, непереносимость лактозы или синдром раздраженного кишечника) сохраняются еще долгое время после того, как инфекция прошла.

Жить с

Когда мне следует позвонить своему лечащему врачу?

Обезвоживание от диареи может быть серьезным.Это особенно опасно для младенцев и женщин во время беременности. Позвоните своему поставщику медицинских услуг, если заметите какие-либо симптомы, которые вас беспокоят. Для ребенка меньшее количество мокрых подгузников, чем обычно, может быть признаком обезвоживания.

Записка из клиники Кливленда

Лямблиоз может вызывать симптомы пищеварения от незначительных до тяжелых, такие как жидкий, жидкий стул и желудочные спазмы. Паразит Giardia может длительное время жить вне организма. Он может выжить в воде или пище, а также на таких поверхностях, как дверные ручки.Вы можете заразиться лямблиозом, выпив неочищенную воду, съев зараженную пищу или контактировав с инфицированными фекалиями. Предотвратите лямблиоз, регулярно мойте руки и не пейте воду, которая может быть небезопасной. Если у вас лямблиоз, ваш лечащий врач может назначить антибиотики для лечения инфекции.

Рефрактерный к лечению лямблиоз: проблемы и решения

1 Отделение инфекционных болезней, Европейская референс-лаборатория паразитов, Istituto Superiore di Sanità, Рим, Италия; 2 Норвежский национальный консультативный отдел по тропическим инфекционным заболеваниям, медицинский факультет, университетская больница Хаукеланд, Берген, Норвегия; 3 Кафедра клинических наук Медицинского факультета Бергенского университета, Берген, Норвегия

Резюме: Giardia является наиболее распространенным паразитарным диарейным возбудителем, поражающим людей, и частой причиной передающихся через воду/пищевые паразитарные заболевания во всем мире.Распространенность лямблиоза выше у детей, проживающих в бедных и негигиеничных условиях в развивающихся странах, а также у путешественников, возвращающихся из высокоэндемичных районов. Клиническая картина лямблиоза неоднородна, с высокой вариабельностью тяжести клинического течения заболевания. Он может стать хроническим или сопровождаться постинфекционными последствиями. В странах с низкой распространенностью, таких как страны Европейского Союза, особенно у пациентов, вернувшихся из Азии, было зарегистрировано тревожное увеличение числа случаев, рефрактерных к обычному лечению нитроимидазолами (например, метронидазолом).Ввиду его актуальности, мы стремимся в этом обзоре резюмировать существующие клинические знания о Giardia , уделяя особое внимание проблеме рефрактерного к лечению лямблиоза. Мы предлагаем рабочее определение клинически лекарственно-устойчивого лямблиоза, обобщаем знания о механизмах резистентности и обсуждаем его клиническое ведение в соответствии с данными исследований и медицинской практикой. Достижения в области разработки и идентификации новых лекарств и потенциальных немедикаментозных альтернатив также рассматриваются с общей целью выявления пробелов в знаниях и предложения будущих направлений исследований.

Ключевые слова: Giardia duodenalis , лямблиоз, лекарственная устойчивость, неэффективность лечения, антигиардиальная терапия

Введение

Giardia duodenalis (син. Giardia lamblia , Giardia кишечная ), именуемая в дальнейшем Giardia , является этиологическим агентом лямблиоза, одного из наиболее распространенных паразитарных диарейных заболеваний. 1,2 Этот жгутиковый простейший также колонизирует проксимальный отдел тонкой кишки (двенадцатиперстную кишку и тощую кишку) более чем у 40 других видов млекопитающих. G. duodenalis можно рассматривать как видовой комплекс из восьми генетических групп (называемых ассоциациями A–H), характеризующихся различным распределением хозяев и степенью специфичности хозяев. 3 Сборы A и B обычно связаны с человеческими инфекциями, но также проявляют способность к зоонозным инфекциям. 3,4 Заражение происходит при употреблении воды или пищи, зараженных устойчивыми к окружающей среде и инфекционными кистами, или при контакте человека с человеком или человека с животным с цистоположительными фекалиями.После приема внутрь из кисты вылупляется трофозоит, который активно размножается и колонизирует тонкий кишечник, и цикл завершается, когда трофозоиты дифференцируются в цисты и выделяются с фекалиями. 5 Передача через воду является основным путем распространения лямблиоза, но Продовольственная и сельскохозяйственная организация Объединенных Наций (ФАО)/ВОЗ также поставила Giardia на 11-е место среди наиболее важных паразитов пищевого происхождения в мире. 6,7 Передача от человека к человеку зарегистрирована при бытовых инфекциях, эпидемические вспышки зарегистрированы в детских садах и учреждениях. 8,9 Распространенность лямблиоза наиболее высока у детей в возрасте до 5 лет. Взрослые в возрасте 30–40 лет, возвращающиеся путешественники, иммигранты/беженцы и гомосексуалы также подвержены риску. 1 Распространенность лямблиоза значительно выше в развивающихся странах (20–30%), чем в промышленно развитых странах (2–5%). 10 Бедность и плохие гигиенические условия явно способствуют передаче инфекции, и бремя лямблиоза в Азии, Африке и Латинской Америке по-прежнему велико. 2,11 В промышленно развитых странах более высокие санитарные стандарты ограничивают распространение болезни, и лямблиоз воспринимается как повторно возникающая инфекция, которая в основном и часто связана со вспышками, связанными с поездками и передачей через воду. 7,12 Тем не менее, были зарегистрированы спорадические и явно местные случаи лямблиоза, не связанные с поездками в анамнезе, которые, вероятно, будут не диагностированы. 10,13 Неблагополучные сообщества и субоптимальные гигиенические условия также в промышленно развитых странах действительно могут способствовать антропонозной и аутохтонной передаче первоначально приобретенных во время путешествий Giardia . 14 В этом обзоре мы стремимся кратко обобщить информацию о клинических проявлениях лямблиоза с особым акцентом на рефрактерном к лечению лямблиозе ввиду его значимости в странах с низкой распространенностью инфекции и относительно редким воздействием, таких как Европейский Союз страны.Рабочее определение клинически лекарственно-резистентного лямблиоза, множественные механизмы, вызывающие резистентность, и возможные причины его появления представлены и обсуждены вместе с его клиническим ведением в соответствии с данными исследований и медицинской практикой. Достижения в области разработки и идентификации новых лекарств и потенциальных немедикаментозных альтернатив также рассматриваются с конечной целью определить пробелы в знаниях и предложить направления будущих исследований.

Общий обзор клинических проявлений лямблиоза

Клиническая картина лямблиоза человека достаточно неоднородна с высокой вариабельностью тяжести клинического течения заболевания.Симптомы обычно появляются в течение 2 недель после проглатывания цист, хотя часто встречается бессимптомная или субклиническая инфекция. 1 Диарея, судороги, тошнота и рвота обычно характеризуют острую фазу и часто связаны с усталостью и потерей веса. 1 Также могут возникать изменения и повреждения поверхности тонкой кишки, недостаточность просветных ферментов и мальабсорбция. 15 После уничтожения паразита симптомы обычно исчезают. Однако у некоторых пациентов инфекция может стать хронической, длящейся месяцы или годы, с симптомами или без них. 16,17

Как истощение, так и когнитивные нарушения были связаны с лямблиозом у детей, 18 и ранняя персистирующая инфекция Giardia была связана с задержкой роста в возрасте 2 лет, как показано в исследовании MAL-ED. 19 Лямблиоз был признан значительным фактором риска развития долгосрочных постинфекционных синдромов, таких как постинфекционное раздражение кишечника и синдром хронической усталости, а также внекишечные последствия (например, артрит и аллергия). 20–23 Крайняя изменчивость клинических проявлений лямблиоза, несомненно, является следствием сложного, еще не до конца выясненного взаимодействия между хозяином и паразитом. Несколько попыток связать симптомы острого лямблиоза либо с наборами А, либо с наборами В оказались безрезультатными. 3,24 Хронический лямблиоз связан с дефицитом иммуноглобулинов хозяина (IgA-опосредованная элиминация Giardia имеет решающее значение на более поздних стадиях инфекции) 3 и недоедание и иммуносупрессия 14,15 кишечная микробиота хозяина на восприимчивость к инфекции Giardia и на патофизиологию заболевания путем реципрокного взаимодействия. 15 Тем не менее, такие данные о лямблиозе у человека все еще отсутствуют.

Варианты противогиардиазной терапии первого ряда

Эффективной и одобренной вакцины против лямблиоза для человека не существует, а фармакотерапия является единственным доступным вариантом лечения лямблиоза. В условиях низкой распространенности всегда рекомендуется лечение подтвержденных случаев лямблиоза, чтобы устранить симптомы и сократить течение болезни. Более того, эффективное лечение может снизить риск постинфекционных осложнений и ограничить распространение инфекции.

Кокрановский обзор 2012 г. выявил всего 19 рандомизированных контролируемых испытаний (РКИ), в которых сравнивали метронидазол (МТЗ), вводимый в течение 5–10 дней, с любым из следующих препаратов: МТЗ (однократная доза), тинидазол, альбендазол (АБЗ), мебендазол и нитазоксанид. 25 Его основной вывод заключался в том, что MTZ и ABZ имеют одинаковую эффективность, при этом ABZ имеет меньше побочных эффектов и более простой режим приема лекарств. Недостаточно испытаний других препаратов, чтобы делать однозначные выводы.

Эффективные одобренные препараты состоят из шести классов соединений, а именно производных 5-нитроимидазолов (5-НИ) и бензимидазолов (БИ), хинакрина, фуразолидона, паромомицина и нитазоксанида (рис. 1).Рис. 1

Примечания: Молекулярные структуры соединений соответствуют указанным в PubChem (http://pubchem.ncbi.nlm.nih.gov). МТЗ (номер PubChem, CID 4173), фуразолидон (CID 5323714), нитазоксанид (CID 41684), АБЗ (CID 2082), хлорохин (CID 2719), хинакрин (CID 237), паромомицин (CID 165580), бацитрацин (CID 100) , ауранофин (CID 16667669), дисульфирам (CID 3117), фумагилин (CID 6

5), омепразол (CID 4594), NBDHEX (CID 9817686).

Сокращения: ABZ, альбендазол; МТЗ, метронидазол.

НИ представляют собой пролекарства, которые в интенсивных восстановительных условиях в анаэробных/микроаэрофильных организмах могут ферментативно восстанавливаться до высокореакционноспособных нитро- или нитрозорадикалов, которые, в свою очередь, могут образовывать аддукты с ДНК, свободными тиолами (т.е. цистеинами) или белковые цистеины. 27 Аддукты вызывают повреждение ДНК, остановку развития клеточного цикла и окислительный стресс, что в конечном итоге приводит к гибели паразита. 28 БИ влияют на скорость и количество сборки микротрубочек, а индукция окислительного стресса также может играть роль в антипаразитарном механизме. 29 МТЗ — прототип 5-НИ. Он был представлен в 1960-х годах и внесен ВОЗ в список основных лекарственных средств. 30 Он по-прежнему считается антигиардиальным средством первого ряда (уровень излечения 80–95%), хотя часто сообщается о неприятных побочных эффектах. 26 Обычная схема: 500 мг МТЗ каждые 8 ​​часов в течение 7–10 дней (или 2 г в течение 3–5 дней).Тинидазол, секнидазол и орнидазол используются в качестве альтернативы в однократной суточной дозе в течение 1 или нескольких дней, имеют более длительный период полувыведения из сыворотки, более высокие показатели клинического / паразитологического излечения и более мягкие побочные эффекты, чем MTZ. 31 БИ АБЗ, фенбендазол и мебендазол обладают антигиардиальной и антигельминтной активностью. Эффективность АБЗ при однократном введении в дозе 400 мг/сут в течение 5–10 дней сравнима с эффективностью МТЗ с меньшим количеством побочных эффектов. 25

Неэффективность лечения и резистентность при Giardia : определение

Независимо от применяемого препарата и режима 100% паразитологическое излечение редко достигается, что означает, что необходимо учитывать неудачу клинического лечения некоторых случаев лямблиоза .Как и в случае с бактериями, использование противомикробных препаратов с течением времени в конечном итоге приводит к резистентности и у паразитов. В соответствии с определением ВОЗ лекарственная устойчивость — это «способность штамма паразита выживать и/или размножаться, несмотря на введение и абсорбцию лекарства в дозах, равных или превышающих обычно рекомендуемые, но в пределах переносимости субъекта. ». 32 Таким образом, лекарственная устойчивость Giardia — это способность этого паразита выживать в присутствии дозы противомикробного препарата, которая обычно убивает его или ограничивает его рост.При обсуждении клинических инфекций принято использовать термин «резистентность к лечению», поскольку может быть много причин неэффективности лечения, одна из которых заключается в том, что заражающий изолят Giardia действительно устойчив к лекарственным средствам. Возможность тестирования или подтверждения устойчивости к лекарственным препаратам в клинических изолятах сильно затруднена из-за хорошо задокументированных трудностей с получением рутинных культур. 33 Культивирование, в случае успеха, может также привести к избирательной предвзятости, которая может изменить состав и генетическое разнообразие в популяции паразита, изначально присутствующей в инфицированном хозяине. 34 Более того, маркеры резистентности неизвестны. Ввиду этих ограничений мы предполагаем, что клинический лекарственно-устойчивый лямблиоз для исследовательских целей присутствует, когда образцы стула остаются положительными на Giardia более 1 недели после завершения лечения и когда исключены другие причины неэффективности лечения и риск повторного заражения. очень низкий.

Рост распространенности резистентного к лечению лямблиоза

Случаи рефрактерного к лечению лямблиоза наблюдались клиницистами на протяжении десятилетий.Однако хорошему изучению проблемы препятствуют немногочисленные и изолированные случаи, рефрактерные к лечению, переменная чувствительность диагностических методов и методологические проблемы исключения других факторов, которые могут повлиять на успех лечения (показаны на рис. 2). Тем не менее, благодаря улучшенным методам диагностики и высокой пропускной способности пациентов клинически устойчивые к MTZ штаммы Giardia в последнее время хорошо задокументированы в условиях низкой распространенности. 35–37 Пять десятилетий чувствительности Giardia к лечению MTZ в настоящее время заменяется растущей резистентностью, и также сообщалось о случаях рефрактерного лямблиоза после лечения всеми другими доступными препаратами.Исследование 170 случаев лямблиоза в Мадриде с 1989 по 2004 г. показало, что 10 (5,8%) неэффективны при применении одной или нескольких начальных схем, содержащих НИ; у двоих был дефицит IgA, а у одного был рак легких. 38 Позже небольшое исследование в Израиле сообщило о 12 пациентах с NI-рефрактерным лямблиозом в период с 2008 по 2013 год. Восемь из этих пациентов, у которых не было выявлено иммунодефицита, были путешественниками, вернувшимися из Азии. 39 Частота рефрактерных к лечению случаев НИ у пациентов с лямблиозом, направленных в Больницу тропических болезней в Лондоне, увеличилась с 15% в 2008 г. до 45% в 2013 г.Инфекции, происходящие с Индийского субконтинента, особенно трудно поддавались лечению, при этом рефрактерные случаи достигали 70%. 35 Аналогичным образом, в ретроспективном исследовании 95 вернувшихся испанских путешественников, посещавших туристическую клинику, у 21 (22%) был рефрактерный лямблиоз, особенно у тех, кто вернулся из азиатских стран. 37 В более позднем исследовании с участием трех специализированных отделений тропических болезней в Барселоне, Испания, был проведен проспективный анализ пациентов с хроническим лямблиозом, и было обнаружено, что около 20% невосприимчивы к лечению тинидазолом или MTZ. 36 Также это исследование подтверждает, что рефрактерные инфекции, происходящие из Азии, были более распространены (70%), чем инфекции, происходящие из других мест. Рефрактерные инфекции в испанском исследовании были вызваны обеими группами A и B, что указывает на то, что несколько циркулирующих штаммов обладают потенциалом устойчивости к NI. Подтверждая это, недавнее чешское исследование генотипирования 47 изолятов показало, что девять из этих (19%) изолятов происходят от пациентов с клинической устойчивостью к MTZ. Было представлено несколько подгрупп группы AII и одна группа изолятов BIII, а множественная лекарственная устойчивость была связана с одним AII и одним изолятом AI. 40 Интересно, что в условиях вспышки нескольких генотипов сборки B 41 остался только один генотип, который присутствовал во всех 17 резистентных изолятах, исследованных у пациентов, направленных в связи с неэффективностью лечения. 42 Этот генотип, вероятно, обладал как вирулентностью, так и чертами толерантности к MTZ, что помогло установить хроническую резистентную к MTZ инфекцию, которая существовала в течение нескольких месяцев у иммунокомпетентных лиц. Сообщалось также о неэффективности лечения ABZ, вводимого отдельно или в комбинации с MTZ. 42–46 Необходимы исследования, чтобы оценить, связано ли это с перекрестной устойчивостью против ABZ у растущего числа изолятов, устойчивых к MTZ, или это независимый признак устойчивости. В регионах, эндемичных по лямблиозу, прерывистое введение ABZ детям в рамках противогельминтных программ с режимом, субоптимальным для лечения лямблиоза, действительно было связано с увеличением бремени Giardia среди пациентов. Рис. 2

Примечания: Факторы, связанные с лекарственным средством, хозяином, паразитом и кишечной микробиотой, перечислены здесь и подробно обсуждаются в основном тексте. Факторы, для которых доказательства все еще скудны, выделены курсивом.

Сокращения: ОВИН, общий вариабельный иммунодефицит; ЛПЗ, лимфопролиферативные заболевания.

Неэффективность лечения Giardia: механизмы лекарственной устойчивости паразитов

Наши знания о механизмах резистентности Giardia ограничены и фрагментарны.Устойчивость к лекарственным средствам относительно легко индуцировать в лабораторных линиях аксенических Giardia , и большая часть исследований механизмов потенциальной устойчивости была проведена на этих клеточных линиях. Резистентность может быть вызвана воздействием на чувствительные к лекарственным средствам трофозоитов постепенно увеличивающихся концентраций лекарственного средства в течение нескольких месяцев. 28,48 Хотя условия культивирования in vitro не могут полностью воссоздать микроаэрофильную среду кишечника in vivo, резистентные лабораторные линии являются ценным источником знаний о регуляторных и метаболических эффектах лекарств и адаптациях, происходящих во время воздействия лекарств.

Большинство исследований механизмов резистентности к Giardia были сосредоточены в основном на МТЗ, но также изучались механизмы резистентности к нитазоксаниду, АБЗ, фуразолидону и хинакрину, 48 , в то время как механизмы резистентности к паромомицину, хлорохину и бацитрацину еще не изучались. расследовано. Имеются также убедительные доказательства того, что некоторая степень перекрестной устойчивости распространена в лабораторных линиях, особенно между нитросоединениями. 48,49 Клиническая резистентность к MTZ была связана с повышенной толерантностью к MTZ у Giardia , выделенных у пациентов, у которых лечение оказалось неэффективным. 50,51 В Giardia имеется несколько ферментов, способных к реакции частичного восстановления, необходимой для превращения MTZ в токсичные метаболиты, включая пируват:ферредоксиноксидоредуктазы (PFOR), Giardia lamblia нитроредуктазу 1 (GlNR1) и тиоредоксинредуктазу. (ТрхР). Другая нитроредуктаза, нитроредуктаза 2 (GlNR2) Giardia lamblia , может полностью деактивировать MTZ, восстанавливая его до нетоксичного аминоимидазола. Довольно последовательным открытием было подавление GlNR1 в устойчивых к MTZ линиях, и было показано, что один изолят содержит нонсенс-мутацию в трети транскриптов гена NR1 , что эффективно снижает уровни этого белка. 52 Другие исследования показали менее последовательные результаты, указывающие на роль PFOR, NR2 и TrxR и зависимых от флавинмононуклеотидов оксидоредуктаз в резистентности к MTZ. 53 Новые «омические» подходы, рассматривающие уровни как РНК, так и белков, позволили изучить экспрессию генов и генных продуктов в изогенных MTZ-чувствительных и MTZ-устойчивых лабораторных линиях. Несколько линий доказательств подчеркивают широкие и вариабельные адаптивные реакции у резистентных изотипов, включая посттранскрипционные и посттрансляционные изменения. 53–55 У устойчивых лабораторных линий наблюдался широкий спектр метаболических адаптаций в путях гликолиза, транспорта электронов, антиоксидантов и ацетилирования. 55 Подтверждая это, другие исследования также приписывают устойчивость к транскрипционной пластичности и широким метаболическим изменениям, включая снижение активности FAD-зависимых оксидоредуктаз, с использованием линий, отобранных in vitro, устойчивых к MTZ и нитазоксаниду. 54–56 Утверждалось, что лабораторно-индуцированная лекарственная устойчивость напоминает способность этого паразита справляться с изменчивыми физиологическими условиями у всеядного человека-хозяина, 56 напоминает всеядного человека-хозяина, где паразит справляется с изменчивыми физиологическими условиями условия, в том числе повышенный нитрозативный стресс, связанный с увеличением потребления мяса за последнее столетие. 57 Возможно, лабораторно-индуцированную лекарственную устойчивость, возникающую как метаболическая адаптация на многих уровнях, правильнее было бы назвать «толерантностью». Термин «резистентные» линии (или изоляты, если они не клонированы) может быть зарезервирован для линий со стабильным генотипическим изменением или приобретенной способностью деактивировать лекарство (т. е. путем латерального переноса генов), что хорошо задокументировано для бактериальной резистентности (рис. 2). Однако различение между ними, очевидно, более затруднено для простейших паразитов, обладающих двумя ядрами и до четырех гаплотипов и, как правило, более развитым арсеналом регуляторных способностей, чем у бактерий.Результаты, полученные на лабораторно-индуцированных устойчивых линиях, также следует интерпретировать с некоторой осторожностью. Изоляты, из которых культивируются эти линии, были получены от пациентов несколько десятилетий назад, в основном принадлежат к зоонозному сообществу AI и могут не быть репрезентативными для изолятов Giardia , циркулирующих и инфицирующих людей в настоящее время. 3 Только небольшая часть из изолятов Giardia может быть успешно выращена in vitro, и эти изоляты могут иметь сильные метаболические отклонения, что делает их менее репрезентативными.Резистентность, медленно индуцируемая в лабораторных линиях, может иметь другую природу, чем быстро растущая клиническая резистентность, наблюдаемая в последнее десятилетие. Растущая резистентность, наблюдаемая, особенно у путешественников, возвращающихся из Азии, свидетельствует о наследственном генетическом признаке Giardia .

Резистентность к лекарственным препаратам, индуцированная в лабораторных условиях, обычно утрачивается или значительно снижается после удаления препарата 58 или прохождения трофозоитов через стадию кисты. 54 Стабильность устойчивости к MTZ в клинических изолятах от пациентов, у которых лечение MTZ оказалось неэффективным, так как исследование показало, что три таких изолята также были менее восприимчивы к MTZ при тестировании на модели новорожденных мышей. 50 Устойчивость к MTZ достигается ценой вирулентности паразита, поскольку некоторые устойчивые к MTZ лабораторные линии либо утратили, либо значительно уменьшили способность инфицировать мышей-сосунков в результате дефекта прикрепления к слизистой оболочке, связанного с нарушением метаболизма глюкозы. 49 Напротив, у других лабораторных линий индуцированная устойчивость к MTZ может сосуществовать с сохраненной инфекционностью. 55 Лабораторная линия 106-2ID 10 стабильно сохраняла устойчивость к MTZ после удаления MTZ в течение 12 недель, демонстрировала хорошую скорость роста и ранее было показано, что она сохраняет цитоадгезивность (хотя и на более низких уровнях) и инфекционность у мышей-сосунков. модель. 49 Различия в инфекционности и молекулярных фенотипах устойчивых линий Giardia позволяют предположить, что возможны множественные фенотипы молекулярной устойчивости. Каждый фенотип представляет собой комплекс изменений в генетической последовательности, уровне транскрипции и функциональной регуляции множества белков, что приводит к снижению восприимчивости к MTZ. Обнаружение нескольких подтипов сборки в клинически резистентных к MTZ случаях подтверждает это. 40

Неэффективность лечения Giardia: факторы хозяина и микробиота кишечника статус (рис. 2). 43 Реинфекция довольно распространена в регионах с высокой заболеваемостью, где плохие санитарно-гигиенические условия и высокая загрязненность окружающей среды, поэтому массовое противогиардиозное медикаментозное лечение инфицированных людей, проживающих в этих районах, ставится под сомнение. 59 В странах с низкой распространенностью реинфекцию следует исключить как основную причину неэффективности лечения. С другой стороны, отклонения от соблюдения режима лечения, такие как несоблюдение предписанной частоты и продолжительности приема лекарств, могут возникать в результате неприятных побочных эффектов, связанных с приемом лекарств, или трудностей с приемом некоторых лекарственных форм. 43 Следует исключить низкокачественные, поддельные или просроченные лекарства, а также изменения фармакокинетики лекарств. Люди с ослабленным иммунитетом, в том числе пациенты с общим вариабельным иммунодефицитом (ОВИН), лимфопролиферативными заболеваниями (ЛПЗ) и ВИЧ/СПИДом, а также пациенты, получающие иммуносупрессивную терапию, такую ​​как трансплантация паренхиматозных органов, по-видимому, более восприимчивы к лямблиозу, 60 и их инфекции часто труднее вылечить, так как лечение часто приводит к неэффективности (рис. 2). 39,43

Независимо от хозяина и паразита причиной неэффективного лечения может быть коинфекция или выделение других микроорганизмов в микробиоте кишечника. Некоторые из них могут обезвредить лекарство посредством метаболической инактивации (например, путем восстановления нитрогруппы MTZ до нетоксичного аминопроизводного; рис. 2). Некоторые микроорганизмы, населяющие кишечник (например, Enterococcus spp. , Clostridium spp., Bacteroides spp., и Escherichia coli ) могут кодировать нечувствительные к кислороду нитроредуктазы типа I, которые инактивируют MTZ. 21 Относительное увеличение Firmicutes (включая Clostridium spp.) и Bacteroides spp., 61 или увеличение Protobacteria, 62 или уменьшение количества 03 0 0 0 0 0 0 0 pp. Энтерококк spp. и энтеробактерии 63 наблюдали на нескольких моделях лямблиоза у мышей.Интересно, что лечение антибиотиками, неэффективными против лямблий , происходит у 25% взрослых пациентов с желудочно-кишечными заболеваниями до постановки правильного диагноза лямблиоза и назначения МТЗ. 64 Эта интересная находка заслуживает дальнейшего изучения. Дисбактериоз, вызванный Giardia , в дополнение к ненужному лечению антибиотиками может потенциально изменить кишечную флору, способствуя пролиферации потенциально патогенных устойчивых к MTZ бактерий, таких как Clostridium difficile . 21

Лечение неудач медикаментозного лечения

Лечение лямблиоза в значительной степени основано на клиническом опыте, а хорошо спланированные лечебные испытания встречаются редко. В случае неэффективности обычного лечения первой линии монотерапией АБЗ или МТЗ (или тинидазолом или секнидазолом) исследований для руководства лечением становится еще меньше.

Монотерапия

При рефрактерном к лечению лямблиозе монотерапия с более длительной продолжительностью или более высокой дозой того же препарата или лечение новыми альтернативными препаратами, как правило, менее эффективны, чем начальное лечение любым данным препаратом.Например, в исследовании с использованием ABZ в качестве терапии второй линии в 10 рефрактерных случаях NI только четыре были излечены, а 1 из 4 был вылечен нитазоксанидом. 39 В сочетании с другими описанными в литературе случаями эффективность монотерапии ABZ в рефрактерных случаях составляет менее 20%. 39 Разработанный в середине 1970-х годов, нитазоксанид получил окончательное одобрение Управления по санитарному надзору за качеством пищевых продуктов и медикаментов США для лечения лямблиоза в 2004 году. . 68 Нитазоксанид имеет мало побочных эффектов, и схема лечения обычно ограничивается 3 днями с эффективностью от 71% до 85% у пациентов, ранее не получавших лечения. 65,66,69,70 В открытом рандомизированном исследовании сравнивали трехдневный прием нитазоксанида два раза в день с однократной дозой тинидазола у кубинских детей и обнаружили, что лечение нитазоксанидом приводит к паразитологическому излечению в 78,4% случаев по сравнению с 90,5% при применении тинидазола. 70 Однако, лечение НИ-рефрактерных случаев в рамках рутинной клинической практики, как сообщается, имеет более низкие показатели успеха: 9 из 18 пациентов были излечены. 35

Аминогликозиды, хорошо известная группа антибиотиков и ингибиторов белкового синтеза, доказали свою эффективность против Giardia . Показатели излечения были относительно хорошими при использовании паромомицина в качестве терапии первой линии 39 , но менее обнадеживающими при рефрактерном к лечению лямблиозе (менее 50%). 35 Аналогичным образом, неомицин показал положительные результаты в рандомизированном клиническом исследовании лиц, ранее не получавших лечения, при этом 20 из 22 пациентов (86%) вылечились. 71 Фуразолидон, производное нитрофурана, имеет такую ​​же эффективность (показатель излечения, 80–96%), что и МТЗ, при использовании в качестве начальной терапии. 72 Он повреждает паразита, производя супероксидные радикалы, которые повреждают ДНК и способность дифференцироваться в форму кисты. 73 Однако эффективность аминогликозидов и фуразолидона в случаях неэффективности лечения не исследовалась. Низкий уровень успеха монотерапии в случаях неэффективности лечения может свидетельствовать о перекрестной резистентности, доказанной in vitro между МТЗ и тинидазолом, МТЗ и АБЗ, а также между нитазоксанидом и хинакрином. 26

Примечательно, что хинакрин (рис. 1), старое антипротозойное соединение, родственное хлорохину и разработанное в 1930-х годах, является единственным лекарственным средством, доказавшим свою эффективность в нескольких исследованиях в качестве монотерапии в случаях неэффективности лечения лямблиоза, с почти 100% излечением показатель. 35–37,39 Хинакрин часто назначается в виде 7-дневного курса лечения, 35,37 , хотя 5-дневный режим оказался столь же эффективным даже у одного ребенка, лечение которого было прекращено через 3 дня из-за неблагоприятных побочных эффектов . 36 Квинакрин, как правило, используется в качестве препарата третьей линии при лямблиозе, в основном из-за его неблагоприятных побочных эффектов. Во время 3-недельного курса лечения двое из трех пациентов сообщили о спутанности сознания, один сообщил о головокружении и один сообщил о ночных кошмарах. 42 Перед применением хинакрина пациентов всегда следует консультировать по поводу редких, но серьезных нейропсихиатрических побочных эффектов, включая психоз, о которых сообщалось во время применения этого препарата. 74 Во время 5-дневного курса лечения хинакрином в исследовании 61 ребенка с лямблиозом, ранее не получавшего лечения, на Кубе временные побочные эффекты включали рвоту (23%), тошноту (23%), головную боль (18%) и желтоватый цвет кожи ( 25%). 75

Комбинированная терапия

Клинический опыт низкой эффективности монотерапии привел к использованию комбинированных препаратов в случаях неэффективности первоначального лечения. 76 Раннее исследование с шестью рефрактерными к лечению случаями, в четырех из которых был подтвержден иммунодефицит, 43 показало, что комбинация хинакрина и MTZ эффективна в пяти случаях, а шестой случай, наконец, ответил на 3-недельное лечение. курс хинакрина и тинидазола. Позже итальянское исследование рандомизировало 20 пациентов, у которых от одного до пяти курсов лечения МТЗ не удались, для получения монотерапии 400 мг АБЗ × 2 в течение 7 дней или комбинированной терапии той же схемы АБЗ и 250 мг МТЗ × 3 в течение 7 дней. 77 В то время как 9 из 10 ответили в группе комбинированной терапии, только 2 из 10 ответили на ABZ отдельно. Это исследование руководило выбором терапии второй линии у 39 пациентов с рефрактерным к MTZ лямблиозом в Норвегии, где такая же комбинация ABZ и MTZ была успешной у 79% пациентов в исследовании с лестницей лечения. Шесть пациентов, у которых не наблюдалось улучшения по этой схеме, получали паромомицин, который был эффективен в 50% случаев, а три оставшихся случая были успешно вылечены комбинированным лечением 100 мг хинакрина × 2 и повышенной дозой 750 мг MTZ × 3 в течение 2 или 3 дней. недели. 42 В небольшой серии случаев из 10 пациентов, у которых начальное лечение НИ было неудачным, двойная или тройная комбинированная терапия с МТЗ, АБЗ, паромомицином или хинакрином была успешной во всех случаях. 38

При неэффективности препаратов основных классов можно прибегнуть к препаратам с другим механизмом действия. Малоизученные препараты от лямблиоза, такие как бацитрацин цинка (рис. 1) 71 , снова могут оказаться актуальными для включения в испытания в качестве монотерапии и в комбинациях. Хлорохин также успешно применялся для лечения лямблиоза, 75,78 , но не было опубликовано никаких данных о его применении в сочетании с другими препаратами или в случаях, не поддающихся лечению НИ.

Было показано, что мебендазол BI эффективен против лямблиоза, 66,75 , но он, вероятно, обладает перекрестной устойчивостью с ABZ. Пирантела памоат, препарат, лицензированный для применения против инфекции Enterobius у людей, продемонстрировал синергический эффект с фебантелом BI против лямблиоза у песчанок. 76 Антигельминтный препарат празиквантел также обладает антигиардиальным эффектом. Недавно был проанализирован ряд сообщений о длительном лечении и необычных комбинациях лекарств. 76

Новые тесты для оценки лекарств

Внедрение высокопроизводительного скрининга (HTS) для оценки чувствительности Giardia к лекарствам сопровождалось возобновлением усилий по разработке, синтезу и высокоскоростной идентификации кандидатов «следующий антигиардиальные препараты поколения. Были успешно преодолены ограничения, связанные с обычными колориметрическими или флуоресцентными анализами из-за состава среды Giardia и необходимости обеспечения микроаэрофильных/анаэробных условий, необходимых для роста Giardia в формате 96-луночных планшетов.Микроаэрофильные/анаэробные условия можно обеспечить, запечатав культуральную чашку в пакет либо с помощью анаэробных генераторов 79 , либо с помощью воздухонепроницаемой клейкой ленты. 80 Оценка содержания клеточного АТФ как показателя количества жизнеспособных клеток без удаления культуральной среды Giardia использовалась для скрининга коллекции из 4096 фармакологически активных соединений в миниатюрном формате 1536-луночного планшета, в результате было получено 11 новых соединений с антигиардиальной активностью, включая фумагиллин, карбадокс и тиоксидазол. 79 Эффективность Malaria Box, набора из 400 различных соединений с противомалярийной активностью, а также других 1600 известных биологически активных молекул, была протестирована с использованием автоматизированного анализа с использованием цифровой фазово-контрастной микроскопии живых клеток, который позволяет проводить автоматизированную оценку Рост Giardia без окрашивания клеток. 81,82 Другие анализы вместо этого полагаются на трансгенных паразитов Giardia , основываясь либо на оценке активности глюкуронидазы в трофозоитах 83 , либо на количестве биолюминесцентного вещества люциферазы в трофозоитах и ​​инцистирующих паразитах, что позволяет проводить биолюминесцентный мониторинг эффективности препарата в модели инфекции мыши с помощью методов визуализации. 84 Последний вариант имеет первостепенное значение, поскольку для доклинической оценки нежелательных фармакокинетических/фармакодинамических свойств требуется все более широкое использование мышиной модели лямблиоза.

Новые многообещающие препараты против Giardia и лекарственные мишени

Модификация фармакофора является продуктивной стратегией повышения эффективности существующих антигиардиальных препаратов и преодоления резистентности, принимая также во внимание различные фенотипы лекарственной устойчивости у этого паразита.Были предприняты систематические структурные модификации существующих нитрогетероциклических препаратов и БИ. 85,86 Например, более 400 новых нитрогетероциклических производных были получены модификациями имидазольного кольца с помощью клик-химии. Многие из соединений показали лучшую активность in vitro, чем MTZ и нитазоксанид, при этом некоторые из них были эффективны (<100 нМ) против устойчивых к нитропрепаратам линий Giardia . 86 Интересно, что в модели мышиной инфекции активность шести выбранных наиболее многообещающих соединений плохо коррелировала с активностью in vitro. 86 Это наблюдение подчеркивает важность тщательной оценки фармакокинетических/фармакодинамических свойств при выборе соединений для дальнейшего перехода к оптимизации клинических исследований.

Создание гибридных (химерных) соединений, сочетающих в себе свойства двух активных молекул, отличающихся структурой и механизмами действия, является еще одним путем создания лекарственных средств. Аналоги нитазоксанида, полученные путем замены исходного фрагмента ацетилсалициловой кислоты различными нестероидными противовоспалительными препаратами, обладают лучшей антигиардиальной активностью, чем MTZ и нитазоксанид, как in vitro, так и в мышиной модели, и имеют высокий индекс селективности (>50) по сравнению с млекопитающими. клеточная линия. 87

Повторное использование утвержденного лекарственного средства является одной из наиболее выгодных стратегий, используемых для выявления новых активных соединений с доклинической активностью. Поскольку исследования безопасности уже проведены, такие соединения проходят ускоренный этап клинических испытаний.

Ауранофин (рис. 1) представляет собой комплекс золота для перорального применения, быстро метаболизирующийся до активной формы золота и в настоящее время одобренный FDA для лечения ревматоидного артрита. 88 Соединение эффективно против Giardia in vitro и на различных моделях заражения грызунов (мыши и песчанки) независимо от используемой группы (A или B) или признака устойчивости к MTZ. 88 Ауранофин ингибирует рекомбинантный TrxR in vitro, но чувствительность к препарату не увеличивается в линии Giardia со сверхэкспрессией TrxR, 88,89 , что указывает на то, что механизм действия частично не зависит от этого фермента. Недавно решенная структура Giardia TrxR, вероятно, поможет решить эту проблему. 90 В поддержку будущих антигиардиальных клинических испытаний безопасность и хорошая переносимость ауранофина при краткосрочной терапии (6 мг/сут перорально в течение 7 дней) были подтверждены в фазе исследования I с участием здоровых добровольцев. 91 Кроме того, количество золота в фекалиях на 7-й день, как мера уровня препарата, было в концентрации, значительно превышающей IC in vitro 50 для Giardia , что подтверждает терапевтическую ценность ауранофина для лечения лямблиоза. 91

Фумагиллин (рис. 1) — сильнодействующий антибиотик из грибка Aspergillus fumigatus , лицензированный до 2016 г. Европейским агентством по лекарственным средствам (EMEA/COMP/82/02) для лечения микроспоридий.Он также представляет собой прототип ряда разрабатываемых ингибиторов ангиогенеза и препаратов против ожирения. 92 Фумагиллин нацелен на фермент метионинаминопептидазу, а также эффективен против Plasmodium spp. 93 Фумагиллин эффективен in vitro в субмикромолярных концентрациях как против Giardia групп A и B, так и в модели инфекции взрослых мышей с использованием изолята группы B, с элиминацией паразитов при гораздо более низких дозах, чем MTZ. 94 Способность фумагиллина преодолевать устойчивость к MTZ in vitro 94 и наблюдение, что он может излечивать пациентов с амебиазом и сочетанной инфекцией с Giardia 95 , делают этот препарат многообещающим, хотя механизм действия у Giardia еще нужно раскрыть.

Дисульфирам (рис. 1) — одобренный FDA препарат, который годами используется для лечения алкогольной зависимости. Предотвращает метаболизм ацетальдегида, основного метаболита алкоголя, ингибируя альдегиддегидрогеназу путем образования дитиодиэтилкарбамоилового аддукта с остатком цистеина в активном центре.Накопление ацетальдегида в крови вызывает неприятные последствия. Эффективность дисульфирама в отношении Giardia была продемонстрирована in vitro на совокупности трофозоитов А и В, на мышиной модели лямблиоза, а также в отношении изолята, устойчивого к МТЗ. 96,97 Дисульфирам, по-видимому, имеет несколько мишеней в Giardia , поскольку он инактивирует как карбаматкиназу (терминальный фермент в пути аргининдигидролазы), так и Giardia lamblia триозофосфатизомеразу (glTIM), ключевой гликолитический фермент. необходим для этого амитохондриального паразита путем ковалентного и селективного тиокарбамоилирования специфических остатков цистеина. 97,98

Омепразол (рис. 1), лансопразол, пантопразол и рабепразол являются ингибиторами протонной помпы (ИПП) и производными БИ, одобренными для лечения кислотозависимых заболеваний желудочно-кишечного тракта и инфекции Helicobacter pylori и действуют как ингибиторы секреции желудочного сока. ИПП накапливаются в виде пролекарств в кислой среде и подвергаются катализируемому кислотой превращению в активное лекарство. Эти препараты необратимо ингибируют Н+/К+-АТФазу путем ковалентного связывания с остатками цистеина в альфа-субъединице. 99 Краткосрочное применение ИПП хорошо переносится и имеет мало побочных эффектов. Коммерчески доступные ИПП активны in vitro в отношении трофозоитов Giardia в диапазоне ABZ 100 и сохраняют свою активность также в отношении устойчивых к MTZ штаммов. 101 Токсическая активность была связана с ингибированием glTIM посредством образования ковалентных аддуктов с Cys-222 (без воздействия на гомолог человеческого фермента). 101 Исследований с использованием животных моделей лямблиоза не проводилось, но косвенные данные свидетельствуют о корреляции между использованием ИПП и снижением риска заражения кишечными простейшими, включая Giardia. 102

Использование уникальных метаболических ферментов Giardia является еще одной стратегией, предпринятой для открытия и разработки антигиардиальных препаратов. Примером может служить препарат NBDHEX, 6-(7-нитро-2,1,3-бензоксадиазол-4-илтио)гексанол, перспективное, не одобренное, противоопухолевое соединение, более эффективное, чем МТЗ, против Giardia трофозоитов in vitro ( Фигура 1). 103 Препарат ингибирует необычную ФАД-зависимую глицерол-3-фосфатдегидрогеназу, фермент, связанный с гликолизом.Позже была доказана плейотропная активность препарата Giardia . NBDHEX напрямую ингибирует TrxR, образуя стабильные ковалентные аддукты с каталитическими остатками Cys, которые далее восстанавливаются TrxR до токсичных нитрорадикалов, которые реагируют со специфическими белковыми цистеинами, и, вероятно, подвергается окислительно-восстановительному циклу с образованием токсичных активных форм кислорода. 90,104 Пока нет данных о его способности преодолевать резистентность к MTZ или его эффективности в моделях инфекций на животных.

Альтернативное немедикаментозное лечение лямблиоза

Использование пробиотиков (препаратов микробных клеток или компонентов микробных клеток) также рассматривалось как альтернатива противолямблиозной фармакотерапии или в сочетании с ней из-за низкой токсичности и стимулирующее действие на иммунную систему хозяина. 105 или Enterococcus faecium или Lactobacillus casei 107,108 от до Giardia -инфицированные песчанки, значительно уменьшает количество цист в стуле и может уменьшить/предотвратить адгезию трофозоитов к поверхности. 108 Сообщалось о значительной синергической активности L. casei в сочетании с ABZ в мышиной модели инфекции, 109 , тогда как в случаях лямблиоза у людей введение пробиотических дрожжей Saccharomyces boulardii повышало активность MTZ по сравнению с монотерапией МТЗ. 110 Антигиардиальная активность пробиотических бактерий была связана с высвобождением специфических токсичных пептидов, таких как бактериоцины из Lactobacillus acidophilus и Lactobacillus plantarum , 111 и ферментов, таких как гидролазы желчных солей (BSH03) из 90 L. johnsonii ( La1 ) и другие лактобациллы, продуцирующие деконъюгированные соли желчных кислот, токсичные для паразита. 112,113 Введение новорожденным мышам, экспериментально инфицированным Giardia , продуцента Lactobacilli с высоким содержанием BSH или очищенного рекомбинантного BSH, способствует элиминации паразитов. 113 Кроме того, введение железосвязывающего гликопротеина лактоферрина, обычно присутствующего в экзокринных выделениях млекопитающих, также следует оценивать с учетом сообщения о лямблиоцидной активности in vitro 114 и более низкой распространенности в сообщениях о колонизации Giardia у детей, получавших бычий лактоферрин в течение 9 мес. 115

Заключение и перспективы на будущее

Растущая устойчивость к НИ вызывает тревогу, поскольку она удлиняет период болезни и стоимость лечения лямблиоза.Основной проблемой при рефрактерном к лечению лямблиозе является понимание механизмов резистентности и доказательная база для его клинического ведения. Первостепенное значение имеет необходимость изучения более свежих изолятов из клинических случаев резистентности к MTZ. Наследственный компонент, вероятно, участвует в недавнем увеличении числа резистентных к MTZ изолятов, но он может быть полигенным и, по крайней мере частично, зависеть от метаболической адаптации и модуляции путей активации/инактивации MTZ. Более легкий доступ к недорогим платформам для секвенирования следующего поколения позволит проводить секвенирование всего генома и поиск наследственных признаков резистентности клинических устойчивых к MTZ изолятов. 116 Методы полногеномного секвенирования цист из образцов стула позволяют анализировать образцы независимо от их культивируемости. 117 Систематическое и комплексное транскриптомное, протеомное и даже метаболомическое исследование должно быть расширено за пределы лабораторно-индуцированных линий лекарственной устойчивости, с конечной целью определить молекулярные тесты (на основе ДНК, антител или количественного определения метаболитов), чтобы помочь клиницистам, проводящим правильные решения. Поскольку Giardia и микробиота хозяина влияют друг на друга, и эта взаимосвязь может определять течение заболевания, хорошо спланированные исследования по характеристике (т. е. с помощью метагеномных подходов) кишечной флоры в большой группе пациентов с рефрактерным к лечению лямблиозом могут помочь. определить возможные сигнатуры микробиома, предсказывающие или связанные с неэффективностью лекарств (т. е. бактерии, устойчивые к MTZ).

Что касается лечебных растворов, то доступны вторичные и третичные препараты и их комбинации, но существует необходимость в более крупных хорошо спланированных клинических испытаниях препаратов второго ряда против лямблиоза (например, короткий курс хинакрина). Хотя потребность в совершенно новых препаратах еще не является острой, недавно открытые соединения могут обеспечить будущее антигиардиальной фармакотерапии, хотя вопросы, касающиеся их механизмов действия, эффективности против изолятов, устойчивых к известным препаратам, а также их безопасности и переносимости, должны быть полностью решены. перейти к клиническим испытаниям.Пробиотики или их высвобождаемые пептиды, с учетом нескольких многообещающих исследований, следует исследовать в качестве потенциально эффективной альтернативной или поддерживающей терапии против лекарственно-устойчивых штаммов Giardia или в лечении резистентных к лечению случаев.

Благодарности

Работа в лаборатории машинного обучения поддерживается Генеральным директоратом по здравоохранению и безопасности пищевых продуктов Европейской Комиссии.

Раскрытие информации

KH получает поддержку Норвежского национального консультативного отдела по тропическим инфекционным заболеваниям университетской больницы Хаукеланда в своей работе, связанной с Giardia .Авторы сообщают об отсутствии других конфликтов интересов в этой работе.

Каталожные номера

1.

Cacciò SM, Lalle SM. Лямблиоз. В: Xiao L, Ryan U, Feng Y, редакторы. Биология паразитов пищевого происхождения . Бока-Ратон: CRC Press; 2015: 175–193.

2.

Kirk MD, Pires SM, Black RE, et al. Оценки Всемирной организации здравоохранения глобального и регионального бремени 22 бактериальных, протозойных и вирусных заболеваний пищевого происхождения, 2010 г.: синтез данных. ПЛОС Мед . 2015;12(12):e1001921.

3.

Cacciò SM, Lalle M, Svärd SG. Специфичность хозяина в комплексе видов Giardia duodenalis. Заразить Genet Evol . Epub 2017 December 7.

4.

Cacciò SM, Beck R, Lalle M, Marinculic A, Pozio E. Многолокусное генотипирование Giardia duodenalis asem003 выявило поразительные различия между Jardia duodenalis ass003 и Intblages duodenalis. Паразитол .2008;38(13):1523–1531.

5.

Адам РД. Биология Giardia lamblia. Clin Microbiol Rev . 2001;14(3):447–475.

6.

Продовольственная и сельскохозяйственная организация Объединенных Наций/Всемирная организация здравоохранения (ФАО/ВОЗ). Многокритериальное ранжирование для управления рисками пищевых паразитов. Серия оценок микробиологического риска № 23 . Рим: ФАО/ВОЗ; 2014.Доступно по адресу: http://www.fao.org/3/a-i3649e.pdf. По состоянию на 2 мая 2018 г.

7.

Эфстратиу А., Онгерт Дж. Э., Каранис П. Передача простейших паразитов через воду: обзор мировых вспышек — обновленная информация за 2011–2016 гг. Вода Res . 2017; 114:14–22.

8.

RCA Томпсона. Лямблиоз как повторно возникающее инфекционное заболевание и его зоонозный потенциал. Int J Parasitol .2000;30(12-13):1259–1267.

9.

Адам Э.А., Йодер Дж.С., Гулд Л.Х., Хлавса М.С., Гаргано Дж.В. Вспышки лямблиоза в США, 1971–2011 гг. Эпидемиол Инфекция . 2016;144(13):2790–2801.

10.

Хорман А., Корпела Х., Сутинен Дж., Ведель Х., Ханнинен М-Л. Мета-анализ оценки распространенности и годовой заболеваемости Giardia spp. и Cryptosporidium spp.инфекций у людей в странах Северной Европы. Int J Parasitol . 2004;34(12):1337–1346.

11.

Всемирная организация здравоохранения Доклад о состоянии здравоохранения в мире, 1996 г. [веб-страница в Интернете]. Борьба с болезнями, способствующими развитию . Женева, Швейцария: Всемирная организация здравоохранения; 1996 г. Доступно по адресу: http://www.who.int/whr/1996/en/. По состоянию на 2 мая 2018 г.

12.

Leder K, Torresi J, Libman MD, et al.Надзор GeoSentinel за болезнями вернувшихся путешественников, 2007-2011 гг. Ann Intern Med. 2013;158(6):456-468.

13.

Карри С.Л., Стефенсон Н., Палмер А.С., Джонс Б.Л., Александр К.Л. Занижение сведений о лямблиозе: время рассмотреть последствия для общественного здравоохранения. Эпидемиол Инфекция . 2017;145(14):3007–3011.

14.

Эскобедо А.А., Алмиралл П., Ханевик К. и др.Лямблиоз: диагноз, который следует рассматривать независимо от условий. Эпидемиол Инфекция . 2018;11:1–3.

15.

Финк М.Ю., Зингер С.М. Пересечение иммунных реакций, микробиоты и патогенеза лямблиоза. Тренды Паразитол . 2017;33(11):901–913.

16.

Эскобедо А.А., Ханевик К., Алмиралл П., Цимерман С., Альфонсо М. Лечение хронической инфекции Giardia . Expert Rev Anti Infect Ther . 2014;12(9):1143–1157.

17.

Мухсен К., Левин М.М. Систематический обзор и метаанализ связи между Giardia lamblia и эндемической детской диареей в развивающихся странах. Клинические инфекционные болезни . 2012;55(приложение_4):S271–S293.

18.

Аджампур ССР, Коши Б., Венкатарамани М. и др. Влияние криптоспоридиозной и лямблиозной диареи на социальную зрелость, интеллект и физическое развитие детей в полугородских трущобах на юге Индии. Энн Троп Педиатр . 2011;31(3):205–212.

19.

Rogawski ET, Bartelt LA, Platts-Mills JA, et al. Детерминанты и влияние инфекции Giardia в первые 2 года жизни в когорте новорожденных MAL-ED. J Pediatric Infect Dis Soc. 2017;6(2):153–160.

20.

Литлескаре С., Рортвейт Г., Эйде Г.Э., Ханевик К., Лангеланд Н., Венсаас К-А. Распространенность синдрома раздраженного кишечника и хронической усталости через 10 лет после заражения Giardia. Клиническая гастроэнтерология и гепатология . 2018;16(7):1064–1072.

21.

Halliez MCM, Buret AG. Внекишечные и отдаленные последствия инфекции Giardia duodenalis. Мир J Гастроэнтерол . 2013;19(47):8974–8985.

22.

Накао Дж.Х., Кольер С.А., Гаргано Дж.В. Лямблиоз и последующий синдром раздраженного кишечника: продольное когортное исследование с использованием данных медицинского страхования. J Заразить Dis . 2017;215(5):798–805.

23.

Дормонд М., Гутьеррес Р.Л., Портер К.К. Инфекция Giardia lamblia увеличивает риск хронических желудочно-кишечных заболеваний. Вакцины Trop Dis Travel Med . 2016;2(1):17.

24.

Робертсон Л.Дж., Ханевик К., Эскобедо А.А., Мёрх К., Лангеланд Н. Лямблиоз – почему иногда симптомы никогда не прекращаются? Тренды Паразитол .2010;26(2):75–82.

25.

Гранадос К.Э., Ревейс Л., Урибе Л.Г., Криолло К.П. Препараты для лечения лямблиоза. Кокрановская база данных Syst Rev . 2012;12(5):CD007787.

26.

Лалле М. Лямблиоз в постгеномную эру: лечение, лекарственная устойчивость и новые терапевтические перспективы. Заражение мишеней для наркотиков . 2010;10(4):283–294.

27.

Dingsdag SA, Hunter N. Метронидазол: обновленная информация о метаболизме, структуре, цитотоксичности и механизмах резистентности. J Antimicrob Chemother . 2018;73(2):265–279.

28.

Ansell BRE, McConville MJ, Ma’ayeh SY, et al. Лекарственная устойчивость Giardia duodenalis. Биотехнолог Адван . 2015;33(6):888–901.

29.

Мартинес-Эспиноса Р., Аргуэльо-Гарсия Р., Сааведра Э., Ортега-Пьеррес Г.Альбендазол вызывает окислительный стресс и повреждение ДНК у паразитических простейших Giardia duodenalis. Фронт Микробиол . 2015;6(286):800.

30.

Всемирная организация здравоохранения [веб-страница в Интернете]. Примерный перечень основных лекарственных средств ВОЗ (20-й перечень) . 2017. Доступно по адресу: http://www.who.int/medicines/publications/essentialmedicines/en/. По состоянию на 2 мая 2018 г.

31.

Ordóñez-Mena JM, McCarthy ND, Fanshawe TR.Сравнительная эффективность препаратов для лечения лямблиоза: систематическое обновление литературы и сетевой метаанализ рандомизированных клинических исследований. J Antimicrob Chemother . 2018;73(3):596–606.

32.

Basco L, Ringwald P. Лекарственно-устойчивая малярия: проблемы с определением и техническими подходами. Санте . 2000;10(1):47–50.

33.

Исаак-Рентон Д.Л., Шахриари Х., Боуи В.Р.Сравнение метода эксцистации лямблий in vitro и in vivo. Appl Environ Microbiol . 1992;58(5):1530–1533.

34.

Эндрюс Р.Х., Чилтон Н.Б., Майрхофер Г. Отбор специфических генотипов кишечной лямблии путем роста in vitro и in vivo. Паразитология . 1992;105(03):375–386.

35.

Набарро ЛЕБ, Левер Р.А., Армстронг М., Чиодини Пл.Увеличение заболеваемости лямблиозом, устойчивым к нитроимидазолу, в Больнице тропических болезней, Лондон: 2008–2013 гг. Клиническая микробиология и инфекции . 2015;21(8):791–796.

36.

Рекена-Мендес А., Гони П., Рубио Э. и др. Использование хинакрина при резистентной к нитроимидазолу Giardia Duodenalis: старый препарат для решения возникающей проблемы. J Заразить Dis . 2017;215(6):946–953.

37.

Муньос Гутьеррес Х., Альдасоро Э., Рекена А. и др. Рефрактерный лямблиоз у испанских путешественников. Travel Med Infect Dis . 2013;11(2):126–129.

38.

. Am J Trop Med Hyg . 2010;83(1):171–173.

39.

Мельцер Э., Лахиш Т., Шварц Э. Лечение лямблиоза после отсутствия ответа на нитроимидазол. Внезапное заражение Dis . 2014;20(10):1738–1740.

40.

Лецова Л., Вайс Ф., Тумова П., Толарова В., Нохынкова Е. Первый мультилокусный анализ генотипа Giardia кишечной у человека в Чешской Республике. Паразитология . 2018; 820:11–1111. Epub 2018 20 марта.

41.

Робертсон Л.Дж., Форберг Т., Хермансен Л., Гьерде Б.К., Лангеланд Н. Молекулярная характеристика изолятов Giardia от клинических инфекций после вспышки, передающейся через воду. J Заразить . 2007;55(1):79–88.

42.

Mørch K, Hanevik K, Robertson LJ, Strand EA, Langeland N. Лечение и генетическая характеристика паразитов при рефрактерном лямблиозе после вспышки в Норвегии. J Заразить .2008;56(4):268–273.

43.

Нэш Т.Э., Ол К.А., Томас Э., Субраманиан Г., Кейзер П., Мур Т.А. Лечение пациентов с рефрактерным лямблиозом. Клинические инфекционные болезни . 2001;33(1):22–28.

44.

Колларич Х., Ешко Е., Видерманн Г. Альбендазол высокоэффективен против кожной мигрирующей личинки, но не против инфекции Giardia: результаты открытого экспериментального исследования у путешественников, возвращающихся из тропиков. Trans R Soc Trop Med Hyg . 1993;87(6):689.

45.

Brasseur P, Favennec L. Два случая лямблиоза, безуспешно леченных альбендазолом. Паразит . 1995;2(4):422.

46.

Аббуд П., Леме В., Гаргала Г. и др. Успешное лечение резистентного к метронидазолу и альбендазолу лямблиоза нитазоксанидом у пациента с синдромом приобретенного иммунодефицита. Клинические инфекционные болезни . 2001;32(12):1792–1794.

47.

Киуи-Кота Л., Моралес-Фигероа Г.Г. Устойчивость кишечных паразитарных инфекций во время национальной кампании по дегельминтизации школьников на северо-западе Мексики: поперечное исследование. Энн Гастроэнтерол . 2012;25(1):57–60.

48.

Лейч Д. Лекарственная устойчивость микроаэрофильного паразита Giardia lamblia. Curr Trop Med Rep . 2015;2(3):128–135.

49.

Тейман-Ярден Н., Миллман М., Лауэт Т. и др. Нарушение прикрепления паразита как стоимость устойчивости к метронидазолу у Giardia lamblia. Антимикробные агенты Chemother . 2011;55(10):4643–4651.

50.

Lemée Vet al. Чувствительность к метронидазолу и альбендазолу 11 клинических изолятов Giardia duodenalis из Франции. J Antimicrob Chemother . 2000;46(5):819–821.

51.

Адагу И.С., Нолдер Д., Уорхерст Д.С., Россиньол Дж.Ф. In vitro активность нитазоксанида и родственных соединений в отношении изолятов Giardia кишечного, Entamoeba histolytica и Trichomonas vaginalis. J Antimicrob Chemother . 2002;49(1):103–111.

52.

Ansell BRE, Baker L, Emery SJ, et al.Транскриптомика указывает на активные и пассивные механизмы резистентности к метронидазолу в трех семенных линиях Giardia. Фронт Микробиол . 2017; 8 (часть 4): 398.

53.

Leitsch D. Обзор метронидазола: старый боевой конь в антимикробной химиотерапии. Паразитология . 2017; 6:1–12. Epub 2017 23 ноября.

54.

Мюллер Дж., Лей С., Фельгер И., Хемфилл А., Мюллер Н.Идентификация дифференциально экспрессируемых генов в клоне Giardia lamblia WB C6, устойчивом к нитазоксаниду и метронидазолу. J Antimicrob Chemother . 2008;62(1):72–82.

55.

Emery SJ, Baker L, Ansell BRE, et al. Дифференциальная экспрессия белков и посттрансляционные модификации у резистентных к метронидазолу Giardia duodenalis. Гигасайнс . 2018;7(4): по состоянию на 14 мая 2018 г. https://academic.oup.com/gigascience/article-abstract/7/4/giy024/48.

56.

Мюллер Дж., Хемфилл А., Мюллер Н. Физиологические аспекты устойчивости к нитропрепаратам у Giardia lamblia. Int J Parasitol . 2018;8(2):271–277.

57.

Хьюз Р., Кросс А.Дж., Поллок Дж.Р., Бингем С. Дозозависимое влияние диетического мяса на эндогенное азотирование толстой кишки. Канцерогенез . 2001;22(1):199–202.

58.

Smith NC, Bryant C, Boreham PFL. Возможные роли пирувата: активность ферредоксиноксидоредуктазы и тиолзависимой пероксидазы и редуктазы в резистентности к нитрогетероциклическим препаратам Giardia кишечная. Int J Parasitol . 1988;18(7):991–997.

59.

Сафар М.Дж., Каффари Дж., Халилян А.Р., Косарян М. Быстрое повторное заражение Giardia lamblia после лечения в гиперэндемичной зоне: аргумент против лечения. Ист Медитерр Хелс J . 2005;11(1-2):73–78.

60.

Солаймани-Мохаммади С., Сингер С.М. Giardia duodenalis: обоюдоострый меч иммунных реакций при лямблиозе. Эксперимент Паразитол . 2010;126(3):292–297.

61.

Битти Дж.К., Акьерман С.В., Мотта Дж.-П. и др. Giardia duodenalis вызывает патогенный дисбиоз биопленок кишечной микробиоты человека. Int J Parasitol . 2017;47(6):311–326.

62.

Бараш Н.Р., Мэлони Дж.Г., Сингер С.М., Доусон СК. Giardia изменяет комменсальное микробное разнообразие в кишечнике мышей. Заразить Иммуном . 2017;85(6):e00948–16.

63.

Паванелли М.Ф., Колли С.М., Гомес М.Л. и др. Сравнительное изучение действия комплексов AII и BIV Giardia duodenalis на слизистую оболочку и микробиоту тонкого кишечника мышей. Биомед Фармакотер . 2018; 101: 563–571.

64.

Beer KD, Collier SA, du F, Gargano JW. Диагностика и практика лечения лямблиоза среди лиц, имеющих коммерческую страховку в США. Клинические инфекционные болезни . 2017;64(9):1244–1250.

65.

Россиньол Дж.Ф., Аюб А., Айерс М.С. Лечение диареи, вызванной Giardia кишечной палочкой и Entamoeba histolytica или Е.dispar: Рандомизированное двойное слепое плацебо-контролируемое исследование нитазоксанида. J Заразить Dis . 2001;184(3):381–384.

66.

Родригес-Гарсия Р., Родригес-Гусман Л.М., Крус-дель-Кастильо А.Х. Эффективность и безопасность мебендазола по сравнению с нитазоксанидом при лечении Giardia lamblia у детей. Рев Гастроэнтерол Мекс . 1999;64(3):122–126.

67.

Фокс Л.М., Сараволац Л.Д.Нитазоксанид: новый тиазолидный противопаразитарный агент. Клинические инфекционные болезни . 2005;40(8):1173–1180.

68.

Hoffman PS, Sisson G, Croxen MA, et al. Противопаразитарное средство нитазоксанид ингибирует пируватоксидоредуктазы Helicobacter pylori, отдельных анаэробных бактерий и паразитов, а также Campylobacter jejuni. Антимикробные агенты Chemother . 2007;51(3):868–876.

69.

Ortiz JJ, Ayoub A, Gargala G, Chegne NL, Favennec L. Рандомизированное клиническое исследование нитазоксанида по сравнению с метронидазолом при лечении симптоматического лямблиоза у детей из Северного Перу. Пищевая фармакология и терапия . 2001;15(9):1409–1415.

70.

Эскобедо А.А., Альварес Г., Гонсалес М.Е. и др. Лечение лямблиоза у детей: однократный прием тинидазола по сравнению с 3-дневным приемом нитазоксанида. Анналы тропической медицины и паразитологии . 2008;102(3):199–207.

71.

Эндрюс Б.Дж., Василе-Бугарин А.С., Василиу Р.П., Джипа Г.Х., Панитеску Д., Ронневиг М.Р. Химиотерапия лямблиоза: рандомизированное клиническое исследование бацитрацина, бацитрацина цинка и комбинации бацитрацина цинка с неомицином. Am J Trop Med Hyg . 1995;52(4):318–321.

72.

Кирос-Буэльна Э.Фуразолидон и метронидазол для лечения лямблиоза у детей. Scand J Гастроэнтерол . 1989; 24 (доп. 169): 65–69.

73.

Хаузен М.А., Фрейтас JCM, Монтейро-Леал Л.Х. Эффекты метронидазола и фуразолидона при дифференцировке Giardia в цисты. Эксперимент Паразитол . 2006;113(3):135–141.

74.

Генел Ф., Эрермис С., Аксу Г., Озтюрк С., Кутукчулер Н.Хинакриноиндуцированные психические расстройства у ребенка с общим вариабельным иммунодефицитом и хроническим лямблиозом. Хум Психофармакол . 2002;17(7):357–359.

75.

Каньете Р., Эскобедо А.А., Гонсалес М.Е., Алмиралл П. Рандомизированное клиническое исследование пятидневной апострофной терапии мебендазолом у детей с симптомами лямблии при лечении хинакрином. Мир J Гастроэнтерол . 2006;12(39):6366–6370.

76.

Эскобедо А.А., Лалле М., Храстник Н.И., и соавт. Комбинированная терапия при лечении лямблиоза: что нам говорят лабораторные и клинические исследования. Акта Троп . 2016; 162:196–205.

77.

Cacopardo B, Patamia I, Bonaccorso V, di Paola O, Bonforte S, Brancati G. Синергический эффект комбинации альбендазола и метронидазола при лечении резистентной к метронидазолу ассоциации. Клин Тер . 1995;146(12):761–767.

78.

Эскобедо А.А., Нуньес Ф.А., Морейра И., Вега Э., Пареха А., Алмиралл П. Сравнение хлорохина, альбендазола и тинидазола при лечении детей с ангиной. Анналы тропической медицины и паразитологии . 2003;97(4):367–371.

79.

Chen CZ, Kulakova L, Southall N, et al. Высокопроизводительный анализ жизнеспособности Giardia lamblia с использованием измерения содержания биолюминесцентного АТФ. Антимикробные агенты Chemother . 2011;55(2):667–675.

80.

Бенере Э., да Луш Р.А.И., Вермеерш М., Кос П., Маес Л. Новый количественный метод микрокультуры in vitro для трофозоитов Giardia duodenalis. J Микробиологические методы . 2007;71(2):101–106.

81.

Гут Дж., Анг К.Х., Легак Дж., Аркин М.Р., Розенталь П.Дж., Маккерроу Дж.Х. Анализ на основе изображений для высокопроизводительного скрининга Giardia lamblia. J Микробиологические методы . 2011;84(3):398–405.

82.

Hart CJS, Munro T, Andrews KT, et al. Новый анализ, основанный на изображениях in vitro, идентифицирует новые лекарственные препараты для лечения лямблиоза. Int J Parasitol . 2017;7(1):83–89.

83.

Müller J, Nillius D, Hehl A, Hemphill A, Müller N. Стабильная экспрессия Escherichia coli -глюкуронидазы A (GusA) в высокой пропускной способности Giardia lamblia: применение к Giardia lamblia тестирование. J Antimicrob Chemother . 2009;64(6):1187–1191.

84.

Barash NR, Nosala C, Pham JK, et al. Giardia Колонизирует и инцистирует в очагах высокой плотности в тонком кишечнике мышей. mSphere . 2017;2(3):e00343–16.

85.

Флорес-Каррильо П., Веласкес-Лопес Х.М., Агуайо-Ортис Р. и др. Синтез, противопротозойная активность и хемоинформатический анализ производных 2-(метилтио)-1H-бензимидазол-5-карбоксамида: идентификация новых селективных лямблицидных и трихомоницидных соединений. Евро J Med Chem . 2017; 137: 211–220.

86.

Kim WJ, Korthals KA, Li S, et al. Click Химическая структурная диверсификация нитротиазолов, нитрофуранов и нитропирролов усиливает противомикробную активность против Giardia lamblia. Антимикробные агенты Chemother . 2017;61(6):e02397–16.

87.

Колин-Лозано Б., Леон-Ривера И., Чан-Бакаб М.Дж. и др.Синтез, in vitro и in vivo противолямблиозная активность химер нитротиазол-НПВП, проявляющих широкий антипротозойный спектр. Bioorg Med Chem Lett . 2017;27(15):3490–3494.

88.

Тейман-Ярден Н., Миямото Ю., Лейч Д. и др. Перепрофилированный препарат ауранофин эффективен против резистентной к метронидазолу Giardia lamblia. Антимикробные агенты Chemother . 2013;57(5):2029–2035.

89.

Лейч Д., Мюллер Дж., Мюллер Н. Оценка тиоредоксинредуктазы Giardia lamblia как фермента, активирующего лекарственное средство, и как мишени лекарственного средства. Int J Parasitol . 2016;6(3):148–153.

90.

Brogi S, Fiorillo A, Chemi G, et al. Структурная характеристика тиоредоксинредуктазы Giardia duodenalis (gTrxR) и компьютерный анализ ее взаимодействия с NBDHEX. Евро J Med Chem . 2017; 135: 479–490.

91.

Каппарелли Э.В., Брикер-Форд Р., Роджерс М.Дж., Маккерроу Дж.Х., Рид С.Л. Результаты I фазы клинических испытаний ауранофина, нового противопаразитарного агента. Антимикробные агенты Chemother . 2016;61(1):e01947–16.

92.

Howland RH. Aspergillus , Ангиогенез и ожирение: история Белораниба. J Psychosoc Nurs Ment Health Serv .2015;53(3):13–16.

93.

Кан Дж. М., Джу Дж. В., Ким Дж. И. и др. Экспрессия и биохимическая характеристика метионинаминопептидазы I типа Plasmodium vivax. Protein Expr Purif . 2015; 108:48–53.

94.

Кулакова Л., Галкин А., Чен Ч.З., и др. Открытие новых кандидатов в лекарства против лямблиоза. Антимикробные агенты Chemother . 2014;58(12):7303–7311.

95.

Киллоу Дж.Х., Мэджилл Г.Б., Смит Р.С. Лечение амебиаза фумагилином. Наука . 1952; 115 (2977): 71–72.

96.

Нэш Т., Райс В.Г. Эффективность цинковых пальцев-активных препаратов против Giardia lamblia. Антимикробные агенты Chemother . 1998;42(6):1488–1492.

97.

Галкин А., Кулакова Л., Лим К. и др.Структурные основы инактивации карбаматкиназы Giardia lamblia дисульфирамом. Журнал биологической химии . 2014;289(15):10502–10509.

98.

Castillo-Villanueva A, Rufino-Gonzalez Y, Méndez S-T, et al. Дисульфирам как новый инактиватор триозофосфатизомеразы Giardia lamblia с антигиардиальным потенциалом. Int J Parasitol . 2017;7(3):425–432.

99.

Нехра А.К., Александр Дж.А., Лофтус К.Г., Нехра В. Ингибиторы протонной помпы: обзор возникающих проблем. Mayo Clin Proc . 2018;93(2):240–246.

100.

Pérez-Villanueva J, Romo-Mancillas A, Hernández-Campos A, Yépez-Mulia L, Hernández-Luis P ингибитор активности протонозола F, Castillo R. Bioorg Med Chem Lett . 2011;21(24):7351–7354.

101.

Reyes-Vivas H, de La Mora-de La Mora I, Castillo-Villanueva A, et al. Жиардиальная триозофосфатизомераза как возможная мишень цитотоксического действия омепразола на Giardia lamblia. Антимикробные агенты Chemother . 2014;58(12):7072–7082.

102.

Шил Дж.М. Использование ингибиторов протонной помпы связано со снижением риска заражения кишечными простейшими. Wilderness Environ Med .2017;28(4):339–341.

103.

Лалле М., Камерини С., Чекетти С. и др. FAD-зависимая глицерол-3-фосфатдегидрогеназа Giardia duodenalis: нетрадиционный фермент, который взаимодействует с g14-3-3 и является мишенью противоопухолевого соединения NBDHEX. Фронт Микробиол . 2015;06(51):544.

104.

Камерини С., Бочеди А., Чекетти С. и др. Протеомный и функциональный анализы выявили плейотропное действие противоопухолевого соединения NBDHEX на Giardia duodenalis. Int J Parasitol . 2017;7(2):147–158.

105.

Витетта Л., Зальцман Э.Т., Ников Т., Ибрагим И., Холл С. Модуляция кишечной микросреды при лечении кишечных паразитов. Дж Клин Мед . 2016;5(11):102.

106.

Humen MA, de Antoni GL, Benyacoub J, et al. Lactobacillus johnsonii La1 противодействует лямблиям кишечным in vivo. Заразить Иммуном .2005;73(2):1265–1269.

107.

Benyacoub J, Pérez PF, Rochat F, et al. Enterococcus faecium SF68 усиливает иммунный ответ на кишечную лямблию у мышей. Дж Нутр . 2005;135(5):1171–1176.

108.

Шукла Г., Деви П., Сегал Р. Влияние Lactobacillus casei как пробиотика на модуляцию лямблиоза. Научные раскопки . 2008;53(10):2671–2679.

109.

Шукла Г., Каур Х., Шарма Л. Сравнительный терапевтический эффект пробиотика Lactobacillus casei отдельно и в сочетании с противопротозойными препаратами при мышином лямблиозе. Паразитол Рез . 2013;112(6):2143–2149.

110.

Бесирбеллиоглу Б.А., Улчай А., Джан М. и др. Saccharomyces boulardii и инфекция, вызванная Giardia lamblia. Scand J Infect Dis .2006;38(6-7):479–481.

111.

Амер Э.И., Моссалам С.Ф., Махрус Х. Терапевтическое усовершенствование недавно полученных бактериоцинов против Giardia lamblia. Эксперимент Паразитол . 2014; 146:52–63.

112.

Трэверс М.А., Соу С., Зира С. и др. Деконъюгированные желчные соли, продуцируемые внеклеточной гидролазоподобной активностью солей желчных кислот пробиотика Lactobacillus johnsonii La1 Inhibit Giardia duodenalis In vitro Рост. Фронт Микробиол . 2016;7:1453.

113.

Аллен Т., Чауч С., Томас М. и др. Активность гидролазы желчных солей: новая мишень для скрининга анти- Giardia Lactobacilli? Фронт Микробиол . 2018;9:89.

114.

Турчаны Ю.М., Алей С.Б., Гиллин Ф.Д. Лямбоцидная активность лактоферрина и N-концевых пептидов. Заразить Иммуном .1995;63(11):4550–4552.

115.

Очоа Т.Дж., Чеа-Ву Э., Кампос М. и др. Влияние добавок лактоферрина на рост и распространенность колонизации Giardia у детей. Клин Infect Dis . 2008; 46 (12): 1881–1883.

116.

Aurrecoechea C, Brestelli J, Brunk BP, et al. GiardiaDB и TrichDB: интегрированные геномные ресурсы для эукариотических простейших патогенов Giardia lamblia и Trichomonas vaginalis. Рез. нуклеиновых кислот . 2009; 37 (выпуск базы данных): D526–D530.

117.

Ханевик К., Баккен Р., Братбакк Х.Р., Сагауг К.С., Лангеланд Н. Секвенирование всего генома клинических изолятов Giardia lamblia. Clin Microbiol Infect . 2015;21(2):192.e1-3.

Причины, симптомы и варианты лечения

Медицинская проверка на сайте Drugs.com. Последнее обновление: 11 октября 2021 г.

Что такое лямблиоз?

Лямблиоз — это кишечное заболевание, вызванное заражением паразитом Giardia lamblia , обитающим в загрязненной воде.Хотя это заболевание чаще всего встречается в развивающихся странах, лямблиоз также является частой причиной заболеваний, передающихся через воду, в Соединенных Штатах. Человек может оставаться инфицированным Giardia до тех пор, пока инфекция не будет диагностирована и вылечена. В развивающихся регионах мира обычно более 20% населения страны имеют текущую инфекцию Giardia . В Соединенных Штатах только 1 или 2 из каждых 10 000 человек заболевают Giardia в течение обычного года, но инфекция обнаруживается примерно у 1 из 3 человек с длительными симптомами диареи, если они недавно путешествовали в развивающуюся страну.

На одном этапе своего жизненного цикла G. lamblia паразиты превращаются в цисты. Контагиозные цисты обнаруживаются в фекалиях инфицированных людей или животных. Вы можете заразиться G. lamblia через:

  • Питьевая вода, зараженная цистами Giardia (обычно из-за контакта воды со сточными водами)
  • Употребление в пищу сырых фруктов или овощей, вымытых в загрязненной воде
  • Употребление в пищу сырых фруктов или овощей из сада, где использовались зараженные удобрения
  • Прикосновение к фекалиям, подгузникам или предметам, испачканным фекалиями, а затем недостаточное мытье рук
  • Непосредственный контакт с инфицированным человеком или животным, а затем недостаточное мытье рук

Г.lamblia  может выжить в холодной хлорированной воде до двух месяцев, и в муниципальном водоснабжении произошли вспышки.

Люди, подверженные наибольшему риску лямблиоза, включают:

  • Дети в детских садах и их семьи
  • Работники дневного ухода
  • Путешественники в развивающиеся страны
  • Туристы, которые пьют неочищенную воду
  • Гомосексуальные мужчины (из-за анального секса)

Вероятность развития лямблиоза у детей в три раза выше, чем у взрослых.Вполне возможно, что человеческий организм со временем вырабатывает некоторый иммунитет к паразиту.

Симптомы

До двух третей инфицированных организмом людей не имеют никаких симптомов. Когда симптомы возникают, они могут появиться внезапно и быть очевидными, или они могут медленно ухудшаться. Как правило, симптомы появляются через одну-три недели после заражения и включают:

  • Водянистая диарея
  • Спазмы в животе
  • Вздутие живота
  • Тошнота с рвотой или без нее
  • Газ
  • Плавающий или необычайно вонючий стул
  • Потеря веса
  • Новая непереносимость молока и молочных продуктов в вашем рационе
  • Субфебрильная лихорадка
  • Потеря аппетита

Для появления некоторых симптомов может потребоваться несколько месяцев или больше, поскольку они вызваны постепенными изменениями в слизистой оболочке кишечника. G. lamblia  препятствует способности организма поглощать жиры, поэтому во время инфекции Giardia ваш стул может содержать больше жира. Вот почему ваш стул может плавать и иметь неприятный запах.

Диагностика

Ваш врач спросит вас о вашей истории путешествий, возможном контакте с зараженной водой во время кемпинга или похода, и есть ли в вашем доме колодезная вода. Если пациент — ребенок, который посещает детский сад, врач спросит о любых недавних вспышках диареи в детском саду.Он или она также рассмотрит симптомы пациента.

Диагноз ставится путем исследования стула на антиген Giardia , белок, вырабатываемый паразитами G. lamblia , или путем выявления цист или паразитов G. lamblia в образцах стула. Может потребоваться сбор нескольких образцов стула, поскольку инфекция может быть обнаружена только в части собранных образцов стула, даже если инфекция присутствует. Нечасто для диагностики может потребоваться осмотр кишечника с помощью процедуры, называемой эндоскопией.В ходе этой процедуры инструмент, называемый эндоскопом, вводится через рот в кишечник. Эндоскоп представляет собой узкий гибкий инструмент в виде шнура, оснащенный камерой. При необходимости врач может использовать эндоскоп для взятия небольшого кусочка ткани из тонкой кишки (биопсия) для исследования в лаборатории.

Ожидаемая продолжительность

Наихудшие симптомы лямблиоза обычно длятся от пяти до семи дней, если не откладывать диагностику и лечение.Симптомы могут полностью исчезнуть после лечения в течение нескольких месяцев, поскольку кишечник нуждается в самовосстановлении. Часто бывает непереносимость молока и других молочных продуктов, содержащих лактозу, в течение первых нескольких месяцев после заражения Giardia . У некоторых людей, которые не лечатся, инфекция может вызывать повторяющиеся приступы боли в животе и диареи в течение года или дольше.

Профилактика

Вакцины, способной предотвратить лямблиоз, не существует.Лекарства для предотвращения инфекции не рекомендуются. Лучший способ предотвратить заражение — хорошие привычки в поездках и соблюдение санитарных норм.

Путешественникам следует проявлять особую осторожность, избегая еды и воды, которые могут быть заражены. Безопаснее всего есть очищенные или приготовленные продукты. Приготовление пищи убивает Giardia паразитов и цист.

Для предотвращения лямблиоза, вызванного загрязненной водой, пейте воду только из утвержденных источников. В походах и во время поездок в развивающиеся страны пейте бутилированную воду или другие напитки в бутылках или банках.Отдыхающие могут пить бутилированную воду, обрабатывать воду йодом в течение восьми и более часов, использовать качественный фильтр для воды или кипятить воду не менее одной минуты. Путешественникам в развивающиеся страны следует избегать употребления напитков, которые подаются со льдом.

Всегда полезно часто мыть руки. Это может снизить риск заражения Giardia дома и во время путешествий. Особенно важно мыть руки после посещения туалета, перед едой, после смены подгузника и ухода за больным человеком или животным.

Лечение

Если вы не получаете лечение от Giardia  инфекции, вы, вероятно, в конечном итоге выздоровеете самостоятельно. Тем не менее, лечение является хорошей идеей для всех, у кого есть симптомы. Лечение также может помочь, если у вас нет симптомов, потому что лечение может предотвратить распространение инфекции среди других. Особенно это касается детей и людей, которые готовят или подают еду.

Обычно назначаемые лекарства, используемые для лечения инфекции Giardia , включают тинидазол (Тиндамакс), нитазоксанид (Алиния) и метронидазол (Флагил).

Врач должен обследовать половых партнеров и людей, имевших тесный контакт с инфицированным человеком, например членов семьи, и рассмотреть вопрос о лечении, даже если у них нет симптомов. Беременные женщины обычно не лечатся лекарствами в течение первого триместра.

Если у вас лямблиоз, обязательно пейте много жидкости, чтобы предотвратить обезвоживание. Лекарства от диареи, отпускаемые без рецепта, такие как лоперамид (Имодиум), могут облегчить ваши симптомы. Часто мойте руки, если у вас лямблиоз или если вы ухаживаете за человеком или животным с этой инфекцией.

Варианты лечения

Следующий список лекарств так или иначе связан с этим заболеванием или используется для его лечения.

Просмотреть дополнительные варианты лечения

Когда звонить специалисту

Обратитесь к врачу, если у вас диарея, особенно если эта диарея длится дольше нескольких дней, вызывает плавающий стул и неприятный запах, или если у вас также есть спазмы в животе, вздутие живота и лихорадка.

Прогноз

У здоровых людей лямблиоз обычно полностью исчезает в течение нескольких недель независимо от лечения.В некоторых случаях Giardia  может быть долгосрочной проблемой, если ее не лечить.

Узнайте больше о лямблиозе

Варианты лечения
Руководства по уходу

Внешние ресурсы

Центры по контролю и профилактике заболеваний
https://www.cdc.gov/

Национальная служба обмена информацией о заболеваниях органов пищеварения
https://www.niddk.nih.gov/health-information/пищеварительные заболевания

 

 

Дополнительная информация

Всегда консультируйтесь со своим поставщиком медицинских услуг, чтобы убедиться, что информация, отображаемая на этой странице, применима к вашим личным обстоятельствам.

Медицинский отказ от ответственности

границ | Рециркуляция группы A Giardia lamblia после лечения метронидазолом в области с группами A, B и E Симпатрическая циркуляция

Введение

Giardia lamblia представляет собой жгутиковое простейшее, инфицирующее тонкий кишечник широкого спектра млекопитающих-хозяев.Передается фекально-оральным путем, что тесно связано с плохими санитарными условиями. Согласно недавним исследованиям, более 183 миллионов человек инфицированы 93 294 Giardia 93 295 в мире (Torgerson et al., 2015).

Филогенетически G. lamblia делится на восемь групп, обозначенных в алфавитном порядке от A до H. Люди в основном заражаются группами A и B (Adam, 2001; Feng and Xiao, 2011; Cacciò et al., 2018). Присутствие комплекса E также было обнаружено, хотя и с гораздо меньшей частотой, чем A и B (Fantinatti et al., 2016; Скалиа и др., 2016; Захеди и др., 2017). Специфические характеристики каждой из различных групп повышают вероятность уникальных факторов, связанных с вирулентностью, патогенезом и чувствительностью к лекарственным средствам. Однако, поскольку инфекция часто протекает бессимптомно, диагностика и лечение инфицированных людей могут быть затруднены.

В Бразилии основным классом препаратов, рекомендуемых для лечения лямблиоза, является 5-нитроимидазол. Несмотря на свою эффективность, препараты 5-нитроимидазола имеют ряд побочных эффектов (Gardner and Hill, 2001).Наиболее часто используемым препаратом является метронидазол из-за его низкой стоимости и легкого доступа. Хотя лечение метронидазолом, по-видимому, эффективно при большинстве инфекций, появляются доказательства увеличения частоты терапевтической неудачи (Tejman-Yarden and Eckmann, 2011; Leitsch, 2015). В Лондоне, Соединенное Королевство, сообщалось о чрезмерном росте персистирующей паразитарной инфекции после лечения 5-нитроимидазолом за период с 2008 по 2013 год, когда число случаев неэффективности лечения увеличилось с 15.от 1 до 40,2% (Nabarro et al., 2015). Это очевидное увеличение можно объяснить рядом причин, таких как неадекватные дозировки, неполные схемы лечения, иммуносупрессия или лекарственная устойчивость (Lemée et al., 2000; Gardner and Hill, 2001; Nash et al., 2001; Escobedo et al., 2014).

В Бразилии инфекция Giardia распространяется по всей стране, и оценочная точечная распространенность может достигать более 50% в районах с социальной и санитарной уязвимостью (Coelho et al., 2017). Это указывает на то, что скорость передачи паразита высока.С другой стороны, на сегодняшний день случаи персистирующей инфекции неизвестны. Мы предполагаем, что биологические характеристики каждой из циркулирующих групп могут влиять на их обнаруженную заболеваемость и чувствительность к лекарственным средствам. Настоящее исследование было предпринято для изучения циркуляции групп G. lamblia в районе с высокой распространенностью инфекции после лечения паразитированных особей метронидазолом.

Материалы и методы

Сбор проб, диагностика и лечение паразитов

Исследование проводилось в детском саду, расположенном в экономически неблагополучном районе Рио-де-Жанейро, Бразилия.В общей сложности 194 ребенка в этом детском саду в возрасте от 10 месяцев до 4 лет были обследованы в течение 2 лет. Ребенок был включен в исследование только после того, как родитель принял приглашение к участию и подписал Условия свободного и осознанного согласия, которые были одобрены Институциональным советом по этике (номер CAAE: 19705613.9.0000.5248) и включали полное раскрытие преимуществ и рисков. . У каждого пациента был собран один первоначальный образец стула для диагностики геогельминтов и простейших.Образцы фекалий подвергались паразитологическому исследованию по методикам Ритчи и Като-Каца. Кроме того, была проведена молекулярная диагностика с помощью ПЦР для выявления присутствия ДНК Giardia (см. ниже).

Лица с положительным диагнозом на патогенные паразиты получали лечение в соответствии с рекомендациями Министерства здравоохранения Бразилии. При инфекциях Giardia пациентам назначали метронидазол в дозе 15 мг/кг/сут перорально (максимум 250 мг) в течение 5 или 7 дней в случае неэффективности лечения.Примерно через 20–35 дней после лечения брали новый образец для определения контроля излечения. Лица, у которых оставался положительный результат, подвергались второму циклу лечения метронидазолом, а затем повторно оценивались через 20 дней (второй контроль лечения). Методология диагностики образцов вылеченного контроля была такой же, как и при первом исследовании.

Экстракция ДНК и молекулярная характеристика

G. lamblia

Образцы хранились при температуре -20°C до проведения молекулярной диагностики и характеризации.Выделение ДНК из кист проводили непосредственно из стула с помощью мини-набора QIAamp DNA Stool (Qiagen, Германия), в основном в соответствии с инструкциями производителя. Двумя исключениями были температура лизиса, которая была увеличена до 95°C, и объем буфера АЕ, используемого для элюирования ДНК, который был уменьшен до 100 мкл. Выделенную ДНК хранили при -20°С до момента использования.

Для генотипирования G. lamblia были использованы участки консервативных генов, кодирующих глутаматдегидрогеназу ( gdh ) и бета-гиардин (β -gia ).Экстрагированную ДНК подвергали ПЦР и гнездовой ПЦР (вторичной ПЦР) в конечном объеме 50 мкл реакции, содержащей 1X ПЦР-буфер, 3 мМ MgCl 2 , 2,5 ед. ДНК-полимеразы Taq (Invitrogen Life Technologies, Бразилия), 200 мкМ трифосфатдезоксирибонуклеотидов dNTP (Invitrogen Life Technologies, Бразилия) и по 0,2 мкМ каждого праймера.

Для амплификации мишени gdh в первичной ПЦР использовали праймеры: GDH 1 (TTCCGTRTYCAGTACAACTC) и GDH 2 (ACCTCGTTCTGRGTGGCGCA), а во вторичной ПЦР: GDh4 (ATGACYGAGCTYCAGAGGCACGT) и GDh5 (GTGGCGCARGGCATGATGCA), согласно Cacciò et., 2008. Для амплификации мишени β -gia использовали праймеры в первичной ПЦР: G7 (AAGCCCGACGACCTCACCCGCAGTGC) и G759 (GAGGCCGCCCTGGATCTTCGAGACGAC) и во вторичной ПЦР: B-GIAF (GAACGAACGAGATCGAGGTCCG) и B-GIAR (CTCGACGAGCTTCGTGTT), согласно Cacciò et al., 2002 и Lalle et al., 2005, соответственно.

В качестве положительного контроля использовали экстракты ДНК из аксенических культур клона С6 штамма WB G. lamblia (АТСС 50803). Отрицательные контроли включали ДНК, выделенную из аксенических культур Entameba histolytica и Trichomonas vaginalis .Успешную амплификацию проверяли электрофорезом в агарозном геле при концентрации 1%.

продукта ПЦР для каждой пары праймеров очищали с помощью набора NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Германия) в соответствии с инструкциями производителя, за исключением времени инкубации в буфере NE, которое было увеличено до 5 мин. Очищенные продукты секвенировали в обоих направлениях в трех экземплярах с использованием набора BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, США).После осаждения реакции образцы анализировали в службе секвенирования платформы для секвенирования ДНК FIOCRUZ (Otto et al., 2007). Каждый эксперимент проводили в трехкратной повторности.

Полученные электрофореграммы были проанализированы на качество в программе Chromas 2.4. Характеристика последовательности была выполнена с использованием основного инструмента поиска локального выравнивания с использованием нуклеотида (BLASTn), и консенсус был получен с помощью программы сборки последовательности CAP3. Нуклеотидные последовательности gdh и β -gia из G.lamblia выровнены по алгоритму CLUSTAL W (Thompson et al., 1994) в пакете Molecular Evolutionary Genetics Analysis (MEGA) 7.0 (Kumar et al., 2016).

Филогенетический анализ был выполнен с использованием программы MEGA 7.0, а используемая оценка расстояния была основана на уравнении Jin and Nei (1990) с использованием 2-параметров модели Kimura). Последовательности новых изолятов в клинических образцах были выровнены с использованием GenBank последовательностей G. lamblia , принадлежащих наборам A, B и E.В качестве внешних групп использовались последовательности из G. psittaci , G. muris и T. vaginalis . Соответствующие инвентарные номера последовательностей указаны между вертикальными чертами на филогенетических деревьях. Кроме того, последовательности фрагментов гена gdh и β -gia были конкатенированы, и сообщалось о начальной загрузке выше 60%.

Было построено

филогенетических дерева с использованием алгоритма объединения соседей (Saitou and Nei, 1987). Наилучшая статистическая модель была определена по наименьшему значению BIC, найденному в MEGA (Kumar et al., 2016), где для обоих генов был выбран параметр Kimura 2. Для каждой конструкции достоверность каждой ветви определялась доверительным пределом с помощью бутстрап-анализа (1000 повторений) (Felsenstein, 1985). Характеристика последовательности G. lamblia , полученная из GenBank и использованная в качестве эталона для построения филогенетического дерева генов gdh и β -gia , представлена ​​в дополнительной таблице 2.

Программное обеспечение Recombination Detection Program версии 4 (RDP4) использовалось для проверки событий рекомбинации в наших изолятах из клинических образцов с использованием выравнивания конкатенированных последовательностей для генов gdh и β -gia (Martin et al., 2015). Существование уникальных событий рекомбинации было подтверждено несколькими методами (RDP, GENECONV, BootScan, MaxiChi, Chimera, SiScan и 3Seq).

Оценка последовательности нуклеотидов в

G. lamblia Трофозоиты, постоянно подвергавшиеся воздействию метронидазола in vitro

Трофозоиты Giardia lamblia из клона W6, штамм WB [ATCC50803], культивировали при 37°C в среде TYI-S-33 с pH 7,0, дополненной 10% инактивированной эмбриональной телячьей сыворотки (Cultilab, Campinas, Бразилия).Трофозоиты постоянно подвергались воздействию метронидазола (МТЗ) (Sigma Chemical Co., Сент-Луис, США) в течение как минимум 16 недель. Экспериментальные группы определяли по концентрации воздействия МТЗ: 1-я группа (МТЗ5) – 5 мкМ; группа (MTZ10) 2, 10 мкМ; группа 3 (MTZ20), 20 мкМ; группа 4 (СМТЗ) – без воздействия метронидазола; и группа 5 (CDMSO), обработанная 0,05% диметилсульфоксидом (Sigma, США), наполнителем для разбавления МТЗ. Концентрацию, необходимую для ингибирования роста паразитов на 50% (IC 50 ), определяли с использованием методологии, описанной Bénéré et al., 2007. Анализы для каждой экспериментальной группы проводились в трех повторностях, и результаты IC 50 определялись с использованием программного обеспечения Prism 6.0 (GraphPad;). Тест ANOVA использовался для статистического анализа.

В конечной точке времени ДНК трофозоита G. lamblia экстрагировали с использованием ДНКазола (1 мл/10 7 паразитов; Invitrogen, Карлсбад, Калифорния, США). Последовательности gdh и β -gia были получены и проанализированы, как описано выше.

Результаты

Частота

Гс.lamblia Заражение и определение устойчивости паразитов после лечения

Всего было взято 194 образца стула у детей, 109 женщин и 85 мужчин. При первом обследовании были обнаружены следующие паразиты: Ascaris lumbricoides (15/194 – 7,73%), Entameba histolytica/dispar (4/194 – 2,06%), Entameba coli (5/194 – 2,58%). ), Endolimax nana (13/194 — 6,70%) и G. lamblia (86/194 — 44,33%) (дополнительная таблица 1).Всех индивидуумов с положительным результатом на G. lamblia лечили метронидазолом, и после лечения 36 человек оставались в исследовательской группе для оценки. Девятнадцать случаев представляли собой стойкую инфекцию после лечения и прошли второй цикл лечения метронидазолом. При определении второго контроля излечения повторно оценивали 18 человек. Из них у пятнадцати все еще был положительный диагноз на G. lamblia (рис. 1). Эти случаи индивидуально отслеживались для других клинических подходов.

Рисунок 1. Схематическое изображение положительности на Giardia lamblia в образцах фекалий детей в разные периоды исследования. Количество образцов, полученных в течение трех оценочных моментов исследования ( Giardia ПЦР-отбор, 1-й контроль отверждения и 2-й контроль отверждения). Gia–: Образцы с отрицательным диагнозом на Giardia с помощью ПЦР; Gia+: Образцы с положительным диагнозом на Giardia с помощью ПЦР.

Генотипирование

G.lamblia , циркулирующие у дошкольников до и после лечения

ДНК G. lamblia , выделенная от 86 детей с положительным результатом при первоначальном диагнозе, была генотипирована с использованием как gdh , так и β- gia в качестве мишеней. Мы наблюдали большую генетическую изменчивость среди изолятов из образцов. Из консенсусных последовательностей образцы были сгруппированы следующим образом: 40 изолятов в наборе А, 21 изолят в наборе В, 17 изолятов в наборе Е и 4 изолята, демонстрирующих характеристики обоих наборов А и Е (рис. 2, 3).Многие различия наблюдались в подкомплексах, характеризующих AI и AII.

Рисунок 3. Филогенетическое дерево изолятов Giardia lamblia , собранных у детей до и после лечения, с помощью алгоритма объединения соседей с использованием двухпараметра Кимуры. (A) Филогенетическое дерево, основанное на последовательностях гена глутаматдегидрогеназы . (B) Филогенетическое дерево, основанное на последовательностях гена бета-гиардина .Последовательности названий обозначаются их инвентарными номерами. Красный ромб: CC1: изолировать из образца первого контроля отверждения и CC2: изолировать из образца второго контроля отверждения.

После первого контрольного исследования лечения 36 диагностированных случаев все еще были положительными на инфекцию Giardia и были повторно оценены. На основании первоначального определения группы набора 19 изолятов были из набора А, 5 изолятов из набора В, 9 изолятов из набора Е и 3 изолята из набора А/Е.После второго курса лечения 13 из 19 детей с набором А, 2 из 5 детей с набором В, 2 из 9 детей с набором Е и 2 из 3 детей с набором А/Е оставались положительными. Генотипирование показало, что 18 из них были сгруппированы как сборка А (таблица 1, рисунок 3 и дополнительный рисунок 1). Любопытно, что сборки B или E не были обнаружены среди положительных людей (рисунок 2 и дополнительный рисунок 1).

Таблица 1. Giardia lamblia Совокупности, обнаруженные при первом диагнозе и после лечения.

Среди лиц, инфицированных комплексом А (11 субъектов) при первой оценке и в первом контроле лечения, 9 изолятов демонстрировали 100% идентичность между изолятами из образцов до и после лечения для двух использованных генных мишеней ( gdh и β — gia ). Три человека представили генотипическую дивергенцию между изолятами из первой проанализированной оценки и первого контрольного лечения. Два показали различия в гене β -gia , а другие показали различия в мишени gdh .

После 2-го курса лечения 15 случаев оставались положительными, при этом 13 изолятов были сгруппированы в группу А, что включало идентификацию уникальной группы. Все последовательности из второго контроля лечения показали 100% идентичность с последовательностью того же индивидуума в первом контроле лечения.

Три образца, которые были положительными после лечения, один из 1-й контрольной группы лечения и два из 2-й контрольной группы лечения, были амплифицированы, но не охарактеризованы.Три других изолята были генотипированы только на основе гена gdh .

Среди лиц, которые представили изоляты, сгруппированные как набор А, в первом исследовании и в последующих контрольных лечениях, 8 случаев показали 100% идентичность изолятов во все три момента анализа.

При использовании RDP4 количество возможных уникальных событий рекомбинации среди связанных последовательностей различалось в зависимости от метода обнаружения (RDP: 13, GENECONV: 15, BootScan: 9, MaxiChi: 9, Chimera: 11, SiScan: 20, 3Seq: 19) .В области гена β -gia было обнаружено несколько событий рекомбинации (RDP: 0, GENECONV: 1, BootScan: 0, MaxiChi: 1, Chimera: 1, SiScan: 1, 3Seq: 2). Наибольшее количество рекомбинаций наблюдалось в области гена gdh (RDP: 13, GENECONV: 9, BootScan: 6, MaxiChi: 6, Chimera: 6, SiScan: 9, 3Seq: 13). Оба изолята сборки B и сборки E представили одно событие рекомбинации. Демонстрация одного и того же филогенетического профиля среди изолятов из каждого кластера сборки. Все другие события рекомбинации наблюдались в сборке А для мишени gdh.

Никаких изменений в нуклеотидных последовательностях

gdh и β -gia Из G. lamblia Трофозоиты не наблюдались после in vitro Воздействие метронидазола

Значения IC 50 групп MTZ5, MTZ10 и MTZ20 были значительно выше, чем у контрольных групп SMTZ и CDMSO. Между группами не наблюдалось различий в нуклеотидных последовательностях (представлено Lopes-Oliveira et al.). Эти результаты показали, что, несмотря на серьезное влияние на выживание паразита, MTZ не вызывает изменений в оцениваемых консервативных генах.

Обсуждение

Передача G. lamblia более распространена в районах без элементарных санитарных условий (водоочистные и канализационные сети), что является реальностью в районах Бразилии с низким доходом. Внутривидовые и межвидовые контакты могут способствовать распространению лямблиоза (Feng and Xiao, 2011), что является реальностью в регионах с низким уровнем дохода, где кошки и собаки могут свободно бродить, а также может присутствовать домашний скот. Эти множественные источники могут увеличить риск заражения, наряду с повторным заражением G.lamblia и может объяснить высокую распространенность инфекции, наблюдаемую в настоящем исследовании. Однако неизвестно, связан ли профиль сборки Giardia с инфекционным бременем.

Здесь были идентифицированы три группы G. lamblia (A, B и E), о которых сообщалось у людей. В нашем исследовании наблюдалась высокая скорость конвергенции между генами-мишенями ( gdh и β -gia ), использованными для генотипирования. Поскольку гены, используемые для генотипирования, считаются консервативными, ожидается хороший дискриминационный потенциал среди наборов (Ryan and Cacciò, 2013).Однако низкая вариабельность нуклеотидов, наблюдаемая среди субкомплексов А, ставит под сомнение эффективность этих генных мишеней для характеристики изолятов в основном в AI и AII (Lebbad et al., 2010, 2011; Ankarklev et al., 2018). Небольшие изменения нуклеотидов могут быть недостаточными или достаточными для дифференцировки в подгруппы. При использовании метода детекции для выявления возможных уникальных событий рекомбинации ген β -gia оказался более консервативным, чем ген gdh . Высокая скорость рекомбинации, наблюдаемая в сборке А гена gdh , указывает на высокую изменчивость среди изолятов этой сборки в этом исследовании.Это оправдывает расхождение в характеристиках субкомплексов AI и AII в генах-мишенях. Могли происходить события рекомбинации между подгруппами AI и AII и между ассоциациями A и E (Xu et al., 2012; Ankarklev et al., 2018). Мы обнаружили четыре случая несоответствия между наборами А и Е, но в этом исследовании не наблюдалось никаких событий рекомбинации. Обычно сообщается об этом несоответствии между комплексами (Cacciò et al., 2008).

Частота сборки А была выше по сравнению с В или Е.Несколько сообщений о сообществах Giardia в Бразилии указывают на региональные различия в распространенности преобладающего циркулирующего сообщества (Coelho et al., 2017). В Рио-де-Жанейро у людей чаще всего идентифицировали комплекс А (Volotão et al., 2007; Fantinatti et al., 2016), хотя набор B (Faria et al., 2016) и набор E (Fantinatti et al. , 2016) уже сообщалось. Настоящие результаты согласуются и подтверждают опубликованный эпидемиологический профиль скоплений Giardia в нашем регионе.

В нашем предыдущем исследовании, проведенном в этом регионе, был идентифицирован комплекс E и особенно комплекс A (Fantinatti et al., 2016). Полученные здесь результаты показывают, что циркуляция этих сообществ все еще актуальна, а набор А распространяется в окружающей среде благодаря домашним животным (Volotão et al., 2007; Fantinatti et al., 2018). Тем не менее, идентификация комплекса В, циркулирующего у инфицированных детей, не была подтверждена, хотя первая идентификация комплекса В в Рио-де-Жанейро была зарегистрирована в тот же период (Faria et al., 2016). Дальнейшие исследования образцов из окружающей среды могут помочь понять преобладание комплекса A.

.

В Бразилии для лечения лямблиоза служба общественного здравоохранения чаще всего использует метронидазол, и в большинстве случаев лечение оказывается эффективным. Однако фактическая частота терапевтической неудачи метронидазола в Бразилии до сих пор неизвестна. Наблюдаемая нами частота продолжающейся инфекции после лечения метронидазолом считалась высокой, поскольку 19 из 36 повторно обследованных детей были инфицированы при первом контроле лечения.Это продолжалось после второго контрольного лечения, где 15 из 18 были положительными. Положительные случаи в контроле лечения могут быть результатом терапевтической неудачи (субдоза препарата, резистентность к паразитам) или повторного заражения (Argüello-García et al., 2004).

Отрицательные результаты лечения метронидазолом, скорее всего, являются терапевтическим успехом. Это событие наблюдалось у лиц, инфицированных тремя различными комплексами. Было высказано предположение, что определенная совокупность может быть связана с длительным течением лямблиоза и случаями сохранения инфекции после лечения (Mørch et al., 2008). Ни один из изолятов из контрольных образцов лечения не был генотипирован как группа B или E. Это может указывать на то, что лечение было эффективным для элиминации этих групп. Однако утверждать, что эти сборки (Б и Е) более чувствительны к действию МТЗ, чем группа А, нельзя. Поскольку клонирование генов в данном исследовании не проводилось, исключить коинфекцию нельзя и была выявлена ​​только одна ассоциация с помощью реакций секвенирования по SANGER.

Поскольку в изучаемом сообществе плохие жилищные условия и плохие элементарные санитарно-гигиенические условия, основная гипотеза состоит в том, что случаи персистентных инфекций являются результатом последовательных инфекций.Это подтверждается теми случаями, когда совокупность, идентифицированная после цикла лечения, отличалась от первой оценки. Сборка А была единственной совокупностью, идентифицированной при 1-м и 2-м контроле отверждения. Учитывая высокую распространенность комплекса А в районе нашего исследования, наиболее вероятно, что повторное заражение будет именно этим комплексом. За исключением трех образцов, между последовательностями, оцененными до и после у одного и того же человека, наблюдалась 100% идентичность. Хотя повторное заражение той же ассоциацией не может быть исключено через короткий промежуток времени, в районе нашего исследования реинфекция была ожидаема примерно у половины детей, инфицированных ассоциацией В или Е в контроле лечения (по данным первого обследования).Это предполагает, что следует учитывать терапевтическую неудачу и резистентность.

Как упоминалось выше, у трех человек, у которых после цикла лечения сохранялся положительный результат на комплекс А, наблюдалась генотипическая дивергенция между первым проанализированным образцом и первым контрольным образцом лечения. Изменения нуклеотидов, вероятно, не были следствием лечения, поскольку эти мишени не были изменены, когда трофозоита Giardia подвергались воздействию различных концентраций MTZ in vitro .Это говорит о том, что эти люди были инфицированы другим штаммом того же комплекса, но с другим подтипом.

Находки в районе нашего исследования позволяют предположить, что дети в течение длительного времени остаются инфицированными G. lamblia . Частые эпизоды повторного заражения и персистенции паразитов были замечательными открытиями в районе нашего исследования. В районах с высокой частотой заражения и реинфекции также ожидается частое применение метронидазола. Однако пока невозможно определить, были ли рецидивирующие случаи связаны с лекарственной устойчивостью паразитов.Продолжительное заражение паразитом Giardia может вызвать снижение уровня жирорастворимых витаминов и стеаторею, а также задержку роста. Воздействие лямблиоза на развитие ребенка усиливает серьезность этого типа инфекции как проблемы общественного здравоохранения, которая, хотя в основном незаметна и не привлекает внимания общественности, требует более пристального внимания. Настоящие результаты поднимают вопрос для районов с высокой частотой заражения: может ли лечение лямблиоза подвергать детей дополнительным неблагоприятным последствиям препарата, одновременно маскируя необходимость мер борьбы с паразитами, которые требуют изменений в государственной политике для поощрения инвестиций в улучшение санитарные условия.

Заявление о доступности данных

Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория/репозиториев и инвентарные номера можно найти в статье/дополнительных материалах.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены Этическим комитетом Института Освальдо Круза (CEP FIOCRUZ/IOC). Письменное информированное согласие на участие в этом исследовании было предоставлено законным опекуном/ближайшим родственником участников.

Вклад авторов

MF: концептуализация, методология, получение финансирования и написание рукописи. ЛЛ-О: методология. TC-F: методология. ПА-Т: методология. ЭВ: методология. АБ: формальный анализ. AD-C: концептуализация, получение финансирования и написание рукописи. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Эта работа была поддержана внутренним финансированием Instituto Oswaldo Cruz (PAEF II-IOC-23-FIO-18-2-53), CNPq (Universal — 435015/2018-4).MF получил финансирование от Universal/CNPq (435015/2018-4). MF был поддержан стипендией от CAPES (Brasil Sem Miséria/Бразильская правительственная программа) и CNPq (PDJ). AD-C имеет исследовательскую стипендию от CNPq и FAPERJ (CNE).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы глубоко благодарны Элизабет Сальгадо и команде детского сада за их безоговорочную поддержку в наборе детей, а также команде Clinica da Familia из CMS Heitor Beltrão-SMS-RJ за клиническую помощь.Мы в долгу перед доктором У. Провансом за его ценный критический обзор и издание на английском языке. Мы хотим поблагодарить Платформу секвенирования ДНК службы секвенирования — Fundação Oswaldo Cruz. Наконец, мы благодарны доктору Октавио Фернандесу за то, что он предоставил нам основу для этого направления исследований.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2020.571104/full#supplementary-material

.

Сноски

Каталожные номера

Адам, Р.Д. (2001). Биология Giardia lamblia . клин. микробиол. Версия . 14, 447–475.

Академия Google

Анкарклев, Дж., Леббад, М., Эйнарссон, Э., Франзен, О., Ахола, Х., Троелл, К., и соавт. (2018). Новое мультилокусное типирование с высоким разрешением изолятов группы А Giardia кишечная выявляет зоонозную передачу, клональные вспышки и рекомбинацию. Заразить. Жене. Эвол. 60, 7–16. doi: 10.1016/j.meegid.2018.02.012

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Аргуэлло-Гарсия, Р., Крус-Сото, М., Ромеро-Монтойя, Л., и Ортега-Пьеррес, Г. (2004). Изменчивость и вариабельность чувствительности к лекарственным препаратам среди изолятов и клонов Giardia duodenalis , подвергшихся воздействию 5-нитроимидазолов и бензимидазолов in vitro . J. Антимикроб. Чемотер. 54, 711–721. doi: 10.1093/jac/dkh488

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бенере Э., да Луз Р. А., Вермеерш М., Кос П. и Маес Л. (2007). Новый количественный метод микрокультуры in vitro для Giardia duodenalis трофозоитов. J. Microbiol. Методы 71, 101–106. doi: 10.1016/j.mimet.2007.07.014

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Cacciò, S.M., Beck, R., Lalle, M., Marinculic, A., and Pozio, E. (2008). Мультилокусное генотипирование Giardia duodenalis выявило поразительные различия между группами A и B. Int. Дж. Паразитол. 38, 1523–1531. doi: 10.1016/j.ijpara.2008.04.008

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Каччио, С.М., Де Джакомо М. и Позио Э. (2002). Анализ последовательности гена бета-гиардина и разработка анализа полиморфизма длины рестрикционного фрагмента полимеразной цепной реакции на генотип цист Giardia duodenalis из образцов фекалий человека. Междунар. Дж. Паразитол. 32, 1023–1030. doi: 10.1016/s0020-7519(02)00068-1

Полнотекстовая перекрестная ссылка | Академия Google

Cacciò, S.M., Lalle, M., and Svärd, S.G. (2018). Специфичность хозяина в комплексе видов Giardia duodenalis . Заразить. Жене. Эвол. 66, 335–345. doi: 10.1016/j.meegid.2017.12.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коэльо, Ч. Х., Дуриган, М., Леал, Д. А. Г., Шнайдер, А. Б., Франко, Р. М. Б., и Сингер, С. М. (2017). Лямблиоз как запущенное заболевание в Бразилии: систематический обзор публикаций за 20 лет. PLoS Негл. Троп. Дис. 11:e0006005. doi: 10.1371/journal.pntd.0006005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Эскобедо, А.А., Ханевик К., Алмиралл П., Симерман С. и Альфонсо М. (2014). Лечение хронической инфекции Giardia . Эксперт Вер. Анти. Заразить. тер. 12, 1143–1157. дои: 10.1586/14787210.2014.3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фантинатти М., Белло А. Р., Фернандес О. и Да-Крус А. М. (2016). Идентификация Giardia lamblia комплекса E у человека указывает на новый антропозоонозный цикл. Дж. Заражение.Дис. 214, 1256–1259. doi: 10.1093/infdis/jiw361

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фантинатти, М., Касека, А.С., Белло, А.Р., Фернандес, О., и Да-Крус, А.М. (2018). Присутствие группы A Giardia lamblia у собак свидетельствует об антропозоонозном цикле паразита в Рио-де-Жанейро, Бразилия. Заразить. Жене. Эвол. 65, 265–269. doi: 10.1016/j.meegid.2018.07.025

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фариа, К.П., Занини Г.М., Диас Г.С., да Силва С. и Соуза М.К. (2016). Молекулярная характеристика Giardia lamblia : первое сообщение о сборке B в человеческих изолятах из Рио-де-Жанейро (Бразилия). PLoS One 11:e0160762. doi: 10.1371/journal.pone.0160762

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фельзенштейн, Дж. (1985). Пределы достоверности филогений: подход с использованием бутстрапа. Эволюция. 39, 783–791. дои: 10.2307/2408678

Полнотекстовая перекрестная ссылка | Академия Google

Гарднер Т.Б. и Хилл Д.Р. (2001). Лечение лямблиоза. клин. микробиол. Ред. 14, 114–128.

Академия Google

Джин Л. и Ней М. (1990). Ограничения эволюционно-экономного метода филогенетического анализа. Мол. биол. Эвол. 7, 82–102.

Академия Google

Кумар С., Стечер Г. и Тамура К. (2016). MEGA7: молекулярно-эволюционный генетический анализ версии 7.0 для больших наборов данных. Мол. биол. Эвол. 33, 1870–1874 гг. doi: 10.1093/molbev/msw054

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лалле, М., Поцио, Э., Капелли, Г., Бруски, Ф., Кротти, Д., и Качио, С. М. (2005). Генетическая гетерогенность локуса бета-гиардин среди изолятов человека и животных Giardia duodenalis и идентификация потенциально зоонозных субгенотипов. Междунар. Дж. Паразитол. 35, 207–213. doi: 10.1016/j.ijpara.2004.10.022

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леббад, М., Маттссон, Дж. Г., Кристенссон, Б., Юнгстрем, Б., Бэкханс, А., Андерссон, Дж. О., и соавт. (2010). От мыши к лосю: мультилокусное генотипирование изолятов Giardia от различных видов животных. Вет. Паразитол. 168, 231–239. doi: 10.1016/j.vetpar.2009.11.003

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леббад, М., Петерссон, И., Карлссон, Л., Botero-Kleiven, S., Andersson, J.O., Svenungsson, B., et al. (2011). Мультилокусное генотипирование человеческих изолятов Giardia предполагает ограниченную зоонозную передачу и связь между комплексом B и метеоризмом у детей. PLoS Негл. Троп. Дис. 5:e1262. doi: 10.1371/journal.pntd.0001262

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леме В., Захария И., Невез Г., Рабодонирина М., Брассер П., Балет Дж. Дж. и др. (2000). Чувствительность к метронидазолу и альбендазолу 11 клинических изолятов Giardia duodenalis из Франции. J. Антимикроб. Чемотер. 46, 819–821. doi: 10.1093/jac/46.5.819

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мартин Д. П., Мюррелл Б., Голден М., Хусал А. и Мухире Б. (2015). RDP4: обнаружение и анализ закономерностей рекомбинации в геномах вирусов. Эволюция вируса. 1:vev003.

Академия Google

Мёрх, К., Ханевик, К., Робертсон, Л.Дж., Странд, Э.А., и Лангеланд, Н. (2008). Лестница лечения и генетическая характеристика паразитов при рефрактерном лямблиозе после вспышки в Норвегии. Дж. Заражение. 56, 268–273. doi: 10.1016/j.jinf.2008.01.013

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Набарро, Л. Э., Левер, Р. А., Армстронг, М., и Чиодини, П. Л. (2015). Повышение заболеваемости лямблиозом, устойчивым к нитроимидазолу, в больнице тропических болезней, Лондон, 2008–2013 гг. клин. микробиол. Заразить. 21, 791–796. doi: 10.1016/j.cmi.2015.04.019

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нэш, Т.Э., Ол, К.А., Томас, Э., Субраманиан, Г., Кайзер, П., и Мур, Т.А. (2001). Лечение больных рефрактерным лямблиозом. клин. Заразить. Дис. 33, 22–28. дои: 10.1086/320886

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Отто, Т. Д., Катаньо, М., Дегрейв, В., и де Миранда, А. Б. (2007). Платформа биоинформатики PDTIS: от последовательности к функции. Ред. Электрон. коммун. Инф. Инов. Сауде 1, 286–294.

Академия Google

Райан, У.и Cacciò, SM (2013). Зоонозный потенциал Giardia. Междунар. Дж. Паразитол. 43, 943–956.

Академия Google

Сайтоу, Н., и Ней, М. (1987). Метод соседнего соединения: новый метод реконструкции филогенетических деревьев. Мол. биол. Эвол. 4, 406–425.

Академия Google

Scalia, L.A., Fava, N.M., Soares, R.M., Limongi, J.E., da Cunha, M.J., Pena, I.F., et al. (2016). Мультилокусное генотипирование Giardia duodenalis у бразильских детей. Пер. Р. Соц. Троп. Мед. Гиг. 110, 343–349.

Академия Google

Томпсон, Дж. Д., Хиггинс, Д. Г., и Гибсон, Т. Дж. (1994). CLUSTAL W: повышение чувствительности прогрессивного множественного выравнивания последовательностей за счет взвешивания последовательностей, штрафов за пробелы для конкретных позиций и выбора матрицы весов. Рез. нуклеиновых кислот. 22, 4673–4680. doi: 10.1093/нар/22.22.4673

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Торгерсон, П.R., Devleesschauwer, B., Praet, N., Speybroeck, N., Willingham, A.L., Kasuga, F., et al. (2015). Оценки Всемирной организации здравоохранения глобального и регионального бремени 11 паразитарных болезней пищевого происхождения, 2010 г.: обобщение данных. PLoS Мед. 12:e1001920. doi: 10.1371/journal.pmed.1001920

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Волотао, А. К., Коста-Маседо, Л. М., Хаддад, Ф. С., Брандао, А., Перальта, Дж. М., и Фернандес, О. (2007). Генотипирование Giardia duodenalis из образцов человека и животных из Бразилии с использованием гена бета-гиардина: филогенетический анализ. Acta Trop. 102, 10–19. doi: 10.1016/j.actatropica.2007.02.010

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сюй, Ф., Джерлстрём-Хультквист, Дж., и Андерссон, Дж. О. (2012). Полногеномный анализ рекомбинации предполагает, что ансамбля Giardia кишечная представляют разные виды. Мол. биол. Эвол. 29, 2895–2898. doi: 10.1093/molbev/mss107

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Захеди, А., Филд Д. и Райан У. (2017). Молекулярное типирование Giardia duodenalis у людей в Квинсленде – первое сообщение о сборке E. Parasitology 144, 1154–1161. дои: 10.1017/s0031182017000439

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лекарственная устойчивость микроаэрофильного паразита Giardia lamblia

  • Buret AG. Патофизиология кишечных инфекций с Giardia duodenalis . Паразит. 2008; 15: 261–5.

    КАС пабмед Статья Google ученый

  • Фартинг М.Дж.Лямблиоз. J Pediatr Gastroenterol Nutr. 1997; 24:79–88.

    КАС пабмед Статья Google ученый

  • Halliez MC, Buret AG. Внекишечные и отдаленные последствия инфекции Giardia duodenalis . Мир J Гастроэнтерол. 2013;19:8974–85.

    Центральный пабмед пабмед Статья Google ученый

  • Центры по контролю и профилактике заболеваний.Паразиты — лямблии. http://www.cdc.gov/parasites/giardia. По состоянию на 10 апреля 2015 г.

  • Tejman-Yarden N, Miyamoto Y, Leitsch D, Santini J, Debnath A, Gut J, et al. Ауранофин, перепрофилированный препарат, эффективен против устойчивых к метронидазолу Giardia lamblia . Противомикробные агенты Chemother. 2013;57:2029–35. Описание ауранофина как перспективного нового антигиардиального препарата.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Кулакова Л., Галкин А., Чен Ч.З., Саутхолл Н., Маруган Дж.Дж., Женг В. и др.Открытие новых кандидатов в противолямблиозные препараты. Противомикробные агенты Chemother. 2014;58:7303–11. Описание фумагиллина как перспективного нового антигиардиального препарата .

    Центральный пабмед пабмед Статья Google ученый

  • Тейман-Ярден Н., Экман Л. Новые подходы к лечению лямблиоза. Curr Opin Infect Dis. 2011; 24:451–6.

    КАС пабмед Статья Google ученый

  • Мёрх К., Ханевик К., Робертсон Л.Дж., Странд Э.А., Лангеланд Н.Лестница лечения и генетическая характеристика паразитов при рефрактерном лямблиозе после вспышки в Норвегии. J заразить дис. 2008; 56: 268–73.

    Google ученый

  • Нэш ТЕ. Лечение инфекций Giardia lamblia . Pediatr Infect Dis J. 2001; 20:193–5.

    КАС пабмед Статья Google ученый

  • Венсаас К.А., Лангеланд Н., Рортвейт Г.Распространенность повторяющихся симптомов после заражения Giardia lamblia в неэндемичных районах. Scand J Prim Health. 2009; 27:12–7.

    Артикул Google ученый

  • Bell CA, Cory M, Fairley TA, Hall JE, Tidwell RR. Взаимосвязь структура-активность аналогов пентамидина против Giardia lamblia и корреляция антигиардиальной активности со сродством к ДНК-связыванию. Противомикробные агенты Chemother. 1991; 35: 1099–107.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Эскобедо А.А., Цимерман С. Лямблиоз: обзор фармакотерапии. Эксперт Опин Фармаколог. 2007; 8: 1885–902.

    КАС пабмед Статья Google ученый

  • Cosar C, Julou L. Активность 1-(2-гидроксиэтил)-2-метил-5-нитроимидазола (RP 8823) против экспериментальных инфекций Trichomonas vaginalis .Анн Инст Пастер (Париж). 1959; 96: 238–41.

    КАС Google ученый

  • Schneider J. Лечение лямблиоза (лямблиоза) метронидазолом. Бык Сок Патол Экзот Филиалес. 1961; 54: 84–95.

    КАС пабмед Google ученый

  • Апкрофт П., Апкрофт Дж.А. Лекарственные мишени и механизмы резистентности анаэробных простейших. Clin Microbiol Rev. 2001; 14:150–64.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Ярлетт Н., Горелл Т.Е., Марчак Р., Мюллер М. Восстановление производных нитроимидазола гидрогеносомными экстрактами Trichomonas vaginalis . Мол Биохим Паразитол. 1985; 14:29–40.

    КАС пабмед Статья Google ученый

  • Samuelson J. Почему метронидазол активен как против бактерий, так и против паразитов.Противомикробные агенты Chemother. 1999;43:1533–41.

    КАС ПабМед Центральный пабмед Google ученый

  • Центры по контролю и профилактике заболеваний. Отчет о канцерогенах, 13-е издание. Метронидазол. http://ntp.niehs.nih.gov/ntp/roc/content/profiles/metronidazole.pdf. По состоянию на 10 апреля 2015 г.

  • Эдвардс DI. Нитроимидазольные препараты – действие и механизмы резистентности. I. Механизмы действия. J Антимикробная химиотерапия.1993; 31:9–20.

    КАС пабмед Статья Google ученый

  • Узликова М., Нохынкова Е. Влияние метронидазола на клеточный цикл и ДНК в метронидазол-чувствительных и резистентных к метронидазолу клеточных линиях Giardia . Мол Биохим Паразитол. 2014; 198:75–81. Это исследование доказывает, что метронидазол повреждает ДНК Giardia .

    КАС пабмед Статья Google ученый

  • Лейч Д., Коларич Д., Уилсон И.Б.Х., Альтманн Ф., Дюшен М.Действие нитроимидазола на Entamoeba histolytica : центральная роль тиоредоксинредуктазы. PLoS биол. 2007; 5:1820–34.

    КАС Статья Google ученый

  • Leitsch D, Kolarich D, Binder M, Stadlmann J, Altmann F, Duchêne M. Trichomonas vaginalis : метронидазол и другие препараты нитроимидазола восстанавливаются флавиновым ферментом тиоредоксинредуктазой и нарушают клеточную окислительно-восстановительную систему. Последствия токсичности и резистентности к нитроимидазолу.Мол микробиол. 2009; 72: 518–36.

    КАС пабмед Статья Google ученый

  • Leitsch D, Schlosser S, Burgess A, Duchêne M. Препараты нитроимидазола различаются по способу действия на паразита человека Giardia lamblia . Internat J Parasitol Drugs Drug Resis. 2012;2:166–70.

    Артикул Google ученый

  • Williams CF, Lloyd D, Kolarich D, Alagesan K, Duchêne M, Cable J, et al.Нарушение внутриклеточного окислительно-восстановительного баланса паразита рыб Diplomonad Spironucleus vortens 5-нитроимидазолами и соединениями, полученными из чеснока. Вет Паразитол. 2012; 190:62–73.

    КАС пабмед Статья Google ученый

  • Гиллин Ф.Д., Даймонд Л.С. Ингибирование клонального роста Giardia lamblia и Entamoeba histolytica метронидазолом, хинакрином и другими антимикробными агентами.J Антимикробная химиотерапия. 1981; 8: 305–16.

    КАС пабмед Статья Google ученый

  • Meloni BP, Thompson RC, Reynoldson JA, Seville P. Альбендазол: более эффективный антигиардиальный агент in vitro, чем метронидазол или тинидазол. Trans R Soc Trop Med Hyg. 1990; 84: 375–9.

    КАС пабмед Статья Google ученый

  • Edlind TD, Hang TL, Chakraborty PR.Активность антигельминтных бензимидазолов против Giardia lamblia in vitro. J заразить дис. 1990; 162:1408–11.

    КАС пабмед Статья Google ученый

  • Рейнольдсон Дж.А., Томпсон Р.К., Мелони Б.П. Эффективность альбендазола in vivo против Giardia duodenalis у мышей. Паразитол рез. 1991; 77: 325–8.

    КАС пабмед Статья Google ученый

  • Солаймани-Мохаммади С., Генкингер Дж.М., Лоффредо К.А., Сингер С.М.Мета-анализ эффективности альбендазола по сравнению с метронидазолом при лечении инфекций, вызванных Giardia duodenalis . PLoS Negl Trop Dis. 2010;4, e682.

    Центральный пабмед пабмед Статья Google ученый

  • ди Мартино Л., Ночерино А., Мантовани М.П. Мебендазол при инфекциях лямблий: подтверждение неэффективности этого лечения. Trans R Soc Trop Med Hyg. 1991; 85: 557–58.

    ПабМед Статья Google ученый

  • Рушам Э.К.Рост числа инфекций Giardia duodenalis среди детей, получающих периодическую антигельминтную терапию в Бангладеш. J Trop Педиатр. 1994;40:329–33.

    КАС пабмед Статья Google ученый

  • Canete R, Escobedo AA, Gonzalez ME, Almirall P. Рандомизированное клиническое исследование пятидневной терапии апострофом с мебендазолом по сравнению с хинакрином при лечении симптоматического лямблиоза у детей. Мир J Гастроэнтерол.2006; 12: 6366–70.

    КАС ПабМед Центральный пабмед Google ученый

  • Алмиралл П., Эскобедо А.А., Айяла И., Альфонсо М., Салазар Ю., Каньете Р. и др. Сравнение мебендазола и секнидазола при лечении лямблиоза у взрослых: рандомизированное открытое клиническое исследование, не имеющее меньшей эффективности. J Паразитол Res. 2011;2011:636857.

    Центральный пабмед пабмед Статья Google ученый

  • Гарднер Т.Б., Хилл Др.Гарднер и Хилл Лечение лямблиоза. Clin Microbiol Rev. 2001; 14:114–28.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Холбертон Д.В., Уорд А.П. Выделение цитоскелета из Giardia . Тубулин и низкомолекулярный белок, ассоциированный с микроленточной структурой. Дж. Клеточные науки. 1981; 47: 139–66.

    КАС пабмед Google ученый

  • Макдональд Л.М., Армсон А., Томпсон А.Р., Рейнольдсон Дж.А.Характеристика связывания бензимидазола с рекомбинантным тубулином из Giardia duodenalis , Encephalitozoon кишечного и Cryptosporidium parvum . Мол Биохим Паразитол. 2004; 138:89–96.

    КАС пабмед Статья Google ученый

  • Chavez B, Cedillo-Rivera R, Martinez-Palomo A. Giardia lamblia : ультраструктурное исследование эффекта бензимидазолов in vitro.J Протозол. 1992; 39: 510–5.

    КАС пабмед Статья Google ученый

  • Жиль Х.М., Хоффман П.С. Лечение кишечных паразитарных инфекций: обзор нитазоксанида. Тенденции Паразитол. 2002; 18:95–97.

    ПабМед Статья Google ученый

  • Адагу И.С., Нолдер Д., Уорхерст Д., Россиньол Дж.Ф. Активность нитазоксанида и родственных соединений in vitro в отношении изолятов Giardia кишечная , Entamoeba histolytica и Trichomonas vaginalis .J Антимикробная химиотерапия. 2002; 49: 103–11.

    КАС пабмед Статья Google ученый

  • Müller J, Rühle G, Müller N, Rossignol JF, Hemphill A. Влияние тиазолидов in vitro на Giardia lamblia WB клон C6, культивируемый в аксене и в кокультуре с клетками Caco2. Противомикробные агенты Chemother. 2006; 50: 162–70.

    Центральный пабмед пабмед Статья Google ученый

  • Хоффман П.С., Сиссон Г., Кроксен М.А., Уэлч К., Харман В.Д., Кремадес Н. и др.Противопаразитарное средство нитазоксанид ингибирует пируватоксидоредуктазы Helicobacter pylori , отдельных анаэробных бактерий и паразитов и Campylobacter jejuni . Противомикробные агенты Chemother. 2007; 51: 868–76.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Müller J, Wastling J, Sanderson S, Müller N, Hemphill A. Новая нитроредуктаза Giardia lamblia , GlNR1, взаимодействует с нитазоксанидом и другими тиазолидами.Противомикробные агенты Chemother. 2007; 51: 1979–86.

    Центральный пабмед пабмед Статья Google ученый

  • Мюллер Дж., Раут С., Лейч Д., Вайтхилингам Дж., Хель А., Норберт М.Н. Сравнительная характеристика двух нитроредуктаз из Giardia lamblia как потенциальных активаторов нитросоединений. Int J Препараты от паразитов с лекарственной устойчивостью. 2015;5:37–43.

    Артикул Google ученый

  • Эхсанян Р., Ван Ваес К., Феллер С.М.Помимо связывания ДНК — обзор потенциальных механизмов, опосредующих терапевтическую активность хинакрина при паразитарных инфекциях, воспалении и раке. Сигнал сотовой связи. 2011;9:13.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Upcroft JA, Campbell RW, Upcroft P. Устойчивый к хинакрину Giardia duodenalis . Паразитология. 1996; 112: 309–13.

    ПабМед Статья Google ученый

  • Эдлинд ТД.Чувствительность Giardia lamblia к ингибиторам синтеза белка аминогликозидов: корреляция со структурой рРНК. Противомикробные агенты Chemother. 1989; 33: 484–8.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Ю Д.К., Ван А.Л., Ван К.С. Стабильная коэкспрессия гена лекарственной устойчивости и гетерологичного гена у древнего паразитического простейшего Giardia lamblia . Мол Биохим Паразитол.1996; 83: 81–91.

    КАС пабмед Статья Google ученый

  • Boreham PF, Phillips RE, Shepherd RW. Сравнение активности некоторых 5-нитроимидазолов и других соединений in vitro в отношении Giardia enteralis . J Антимикробная химиотерапия. 1985; 16: 589–95.

    КАС пабмед Статья Google ученый

  • Нэш ТЕ. Разгадка того, как инфекции Giardia вызывают заболевание.Джей Клин Инвест. 2013; 123:2346–7.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Тацуми К., Ямада Х., Йошимура Х., Кавазоэ Ю. Метаболизм фуразолидона ксантиноксидазой молока и крысиной печенью 9000 г супернатанта: образование уникального метаболита нитрофурана и производного аминофурана. Арх Биохим Биофиз. 1981; 208: 167–74.

    КАС пабмед Статья Google ученый

  • Upcroft JA, Upcroft P, Boreham PF.Лекарственная устойчивость Giardia кишечная . Int J Паразитол. 1990; 20: 489–96.

    КАС пабмед Статья Google ученый

  • Brown DM, Upcroft JA, Upcroft P. A H 2 О-продуцирующая НАДН-оксидаза из простейших паразитов Giardia duodenalis . Евр Дж Биохим. 1996; 241:155–61.

    КАС пабмед Статья Google ученый

  • Диас Э.Г., Монтальто де Мекка М., Кастро Х.А.Реакции нифуртимокса с критическими сульфгидрилсодержащими биомолекулами: их потенциальное токсикологическое значение. J Appl Toxicol. 2004; 24:189–95.

    ПабМед Статья Google ученый

  • Maya JD, Repetto Y, Agosin M, Ojeda JM, Tellez R, Gaule C, et al. Влияние нифуртимокса и бензонидазола на содержание глутатиона и трипанотиона в эпимастиготной, трипомастиготной и амастиготной формах Trypanosoma cruzi .Мол Биохим Паразитол. 1997; 86: 101–6.

    КАС пабмед Google ученый

  • Эндрюс Б.Дж., Панитеску Д., Джипа Г.Х., Василе-Бугарин А.С., Василиу Р.П., Ронневиг М.Р. Химиотерапия лямблиоза: рандомизированное клиническое исследование бацитрацина, бацитрацина цинка и комбинации бацитрацина цинка с неомицином. Am J Trop Med Hyg. 1995; 52: 318–21.

    КАС пабмед Google ученый

  • Эндрюс Б.Дж., Милваганам Х., Юл А.Чувствительность Trichomonas vaginalis , Tritrichomonas fetus и Giardia кишечного к бацитрацину и его соли цинка in vitro. Trans R Soc Trop Med Hyg. 1994; 88: 704–6.

    КАС пабмед Статья Google ученый

  • Smith PD, Gillin FD, Spira WM, Nash TE. Хронический лямблиоз: исследования чувствительности к лекарствам, продукции токсинов и иммунного ответа хозяина. Гастроэнтерология. 1982; 83: 797–803.

    КАС пабмед Google ученый

  • Farbey MD, Reynoldson JA, Thompson RC. Чувствительность к лекарственным средствам in vitro 29 изолятов Giardia duodenalis , полученных от человека, по оценке с помощью анализа адгезии. Int J Паразитол. 1995; 25: 593–9.

    КАС пабмед Статья Google ученый

  • Леме В., Захария И., Невез Г., Рабодонирина М., Брассер П., Балет Ж.-Дж. и др.Чувствительность к метронидазолу и альбендазолу 11 клинических изолятов Giardia duodenalis из Франции. J Антимикробная химиотерапия. 2000;46:819–21.

    ПабМед Статья Google ученый

  • Boreham PF, Phillips RE, Shepherd RW. Изменение поглощения метронидазола in vitro штаммами Giardia кишечная с различной чувствительностью к лекарственным средствам. Trans R Soc Trop Med Hyg. 1988; 82: 104–6.

    КАС пабмед Статья Google ученый

  • Таунсон С.М., Апкрофт Дж.А., Апкрофт П.Характеристика и очистка пируват:ферредоксиноксидоредуктазы из Giardia duodenalis . Мол Биохим Паразитол. 1996; 79: 183–93.

    КАС пабмед Статья Google ученый

  • Argüello-García R, Cruz-Soto M, Romero-Montoya L, Ortega-Pierres G. Устойчивость in vitro к 5-нитроимидазолам и бензимидазолам у Giardia duodenalis : изменчивость и изменчивость экспрессии генов. Заразить Генет Эвол.2009; 9: 1057–64.

    ПабМед Статья Google ученый

  • Нарикава С. Распределение факторов чувствительности к метронидазолу у облигатных анаэробов. Дж. Антимироб Чемотер. 1986; 18: 565–74.

    КАС Статья Google ученый

  • Марчак Р., Горрелл Т.Е., Мюллер М. Гидрогеносомный ферредоксин анаэробных простейших, Tritrichomonas fetus .Дж. Биол. Хим. 1983; 258:12427–33.

    КАС пабмед Google ученый

  • Лю С.М., Браун Д.М., О’Донохью П., Апкрофт П., Апкрофт Дж.А. Участие ферредоксина в резистентности к метронидазолу Giardia duodenalis . Мол Биохим Паразитол. 2000; 108: 137–40.

    КАС пабмед Статья Google ученый

  • Чепмен А., Каммак Р., Линстед Д., Ллойд Д.Генерация радикалов метронидазола в гидрогеносомах, выделенных из Trichomonas vaginalis . J Gen Microbiol. 1985; 131:2141–4.

    КАС пабмед Google ученый

  • Smith NC, Bryant C, Boreham PF. Возможная роль активности пируват:ферредоксиноксидоредуктазы и тиолзависимой пероксидазы и редуктазы в резистентности к нитрогетероциклическим препаратам у Giardia enteralis . Int J Паразитол. 1988; 18: 991–7.

    ПабМед Статья Google ученый

  • Ellis JE, Wingfield JM, Cole D, Boreham PF, Lloyd D. Сродство к кислороду устойчивых и чувствительных к метронидазолу штаммов Giardia кишечная . Int J Паразитол. 1993; 23:35–9.

    КАС пабмед Статья Google ученый

  • Leitsch D, Burgess AG, Dunn LA, Krauer KG, Tan K, Duchêne M, et al.Пируват:ферредоксиноксидоредуктаза и тиоредоксинредуктаза участвуют в активации 5-нитроимидазола, в то время как метаболизм флавина связан с устойчивостью к 5-нитроимидазолу у Giardia lamblia . J Антимикробная химиотерапия. 2011;66:1756–65.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Дэн М., Ван А.Л., Ван К.С. Ингибирование экспрессии гена пируват-ферредоксиноксидоредуктазы в Giardia lamblia с помощью рибозима, опосредованного вирусом.Мол микробиол. 2000; 36: 447–56.

    КАС пабмед Статья Google ученый

  • Dunn LA, Burgess AG, Krauer KG, Eckmann L, Vanelle P, Crozet MD, et al. 5-нитроимидазол нового поколения может индуцировать Giardia lamblia с высокой устойчивостью к метронидазолу in vitro. Противомикробные агенты Int J. 2010; 36:37–42.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Ниллиус Д., Мюллер Дж., Мюллер Н.Нитроредуктаза (GlNR1) повышает чувствительность Giardia lamblia и Escherichia coli к нитропрепаратам. J Антимикробная химиотерапия. 2011;66:1029–35.

    КАС пабмед Статья Google ученый

  • Müller J, Schildknecht P, Müller N. Метаболизм нитропрепаратов метронидазола и нитазоксанида в Giardia lamblia : характеристика новой нитроредуктазы (GlNR2). J Антимикробная химиотерапия.2013;68:1781–9. Роль нитроредуктазы 2 как детерминана устойчивости к метронидазолу .

    ПабМед Статья Google ученый

  • Тейман-Ярден Н., Миллман М., Лауват Т., Дэвидс Б.Дж., Гиллин Ф.Д., Данн Л. и др. Нарушение прикрепления паразита как стоимость устойчивости к метронидазолу у Giardia lamblia . Противомикробные агенты Chemother. 2011;55:4643–51.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Мюллер М., Горрелл Т.Е.Метаболизм и поглощение метронидазола у изолятов Trichomonas vaginalis с различной чувствительностью к метронидазолу. Противомикробные агенты Chemother. 1983; 24: 667–73.

    Центральный пабмед пабмед Статья Google ученый

  • Yarlett N, Yarlett NC, Lloyd D. Резистентные к метронидазолу клинические изоляты Trichomonas vaginalis имеют пониженное сродство к кислороду. Мол Биохим Паразитол. 1986; 19: 111–6.

    КАС пабмед Статья Google ученый

  • Кулда Дж.Трихомонады, гидрогеносомы и лекарственная устойчивость. Int J Паразитол. 1999; 29:199–212.

    КАС пабмед Статья Google ученый

  • Расолосон Д., Ванакова С., Томкова Е., Разга Дж., Хрди И., Тачези Дж. и др. Механизмы развития резистентности к метронидазолу in vitro у Trichomonas vaginalis . Микробиология. 2002; 48: 2467–77.

    Google ученый

  • Лейч Д., Дринич М., Дюшен М.Понижающая регуляция флавинредуктазы и алкогольдегидрогеназы-1 (АДГ-1) в резистентных к метронидазолу изолятах Trichomonas vaginalis . Мол Биохим Паразитол. 2012; 183:177–83.

    КАС пабмед Статья Google ученый

  • Meingassner JG, Thurner J. Штамм Trichomonas vaginalis , устойчивый к метронидазолу и другим 5-нитроимидазолам. Противомикробные агенты Chemother. 1979; 16: 254–7.

    Артикул Google ученый

  • Лейч Д., Янссен Б.Д., Коларич Д., Джонсон П.Дж., Дюшен М. Trichomonas vaginalis Флавинредуктаза 1 (FR1) и ее роль в резистентности к метронидазолу. Мол микробиол. 2014;91:198–208.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Мюллер Дж., Лей С., Фельгер И., Хемфилл А., Мюллер Н. Идентификация дифференциально экспрессируемых генов в клоне Giardia lamblia WB C6, устойчивом к нитазоксаниду и метронидазолу. J Антимикробная химиотерапия. 2008;62:72–82.

    ПабМед Статья Google ученый

  • Upcroft J, Mitchell R, Chen N, Upcroft P. Устойчивость к альбендазолу у Giardia коррелирует с изменениями цитоскелета, но не с мутацией аминокислоты 200 в бета-тубулине. Устойчивость к микробам. 1996; 2: 303–8.

    КАС пабмед Статья Google ученый

  • Хименес-Кардосо Э., Элихио-Гарсия Л., Кортес-Кампос А., Флорес-Луна А., Валенсия-Майораль П., Лосада-Чавес И.Изменения в последовательности бета-гиардина Giardia кишечная чувствительных и устойчивых к альбендазолу штаммов. Паразитол рез. 2009; 105:25–33.

    ПабМед Статья Google ученый

  • Paz-Maldonado MT, Argüello-García R, Cruz-Soto M, Mendoza-Hernandez G, Ortega-Pierres G. Протеомный и транскрипционный анализ генов, дифференциально экспрессируемых в клонах Giardia duodenalis , устойчивых к альбендазолу. Заразить Генет Эвол.2013;15:10–7.

    КАС пабмед Статья Google ученый

  • Бич Р.Н., Скьюс П., Бартли Д.Дж., Мартин Р.Дж., Причард Р.К., Гиллеард Д.С. Антигельминтная резистентность: маркеры резистентности или восприимчивости? Паразитология. 2011; 138:160–74.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Докампо Р., Мейсон Р.П., Моттли С., Мунис Р.П. Генерация свободных радикалов, индуцированная нифуртимоксом в тканях млекопитающих.Дж. Биол. Хим. 1981; 256:10930–3.

    КАС пабмед Google ученый

  • Бенере Э., да Лус Р.А., Вермеерш М., Кос П., Маес Л. Новый количественный метод микрокультуры in vitro для Giardia duodenalis трофозоитов. J Микробиологические методы. 2007;71:101–6.

    ПабМед Статья Google ученый

  • Стерк М., Мюллер Дж., Хемфилл А., Мюллер Н. Характеристика клона Giardia lamblia WB C6, устойчивого к изофлавону формононетину.Микробиология. 2007; 153:4150–8.

    КАС пабмед Статья Google ученый

  • Лауэт Т., Андерсен Ю., Ван де Вен Л., Экманн Л., Гиллин Ф.Д. Быстрое отделение трофозоитов Giardia lamblia как механизм антимикробного действия изофлавона формононетина. J Антимикробная химиотерапия. 2010;65:531–4.

    КАС ПабМед Центральный пабмед Статья Google ученый

  • Харрис Дж. К., Пламмер С., Ллойд Д.Антигиардиальные препараты. Приложение Microbiol Biotechnol. 2001; 57: 614–9.

    КАС пабмед Статья Google ученый

  • Giardia Intestinalis Infections — HealthyChildren.org

    Лямблиоз — это название, которое врачи дают инфекциям, вызываемым микроскопическим паразитом, называемым Лямблии кишечные . Этот организм может быть обнаружен в стуле инфицированного человека. Он может передаваться от человека к человеку в таких местах, как детские сады, и среди членов семьи, которые не принимали должным образом мыли руки после посещения туалета или переодевания подгузники.Giardia также может присутствовать в зараженных пищевых продуктах и ​​воде и представляет опасность для отдыхающие пьют неочищенную воду из горных ручьев, которая может быть загрязнена испражнениями инфицированных животных и отдыхающих.

    Признаки и симптомы

    Большинство детей с Инфекция Giardia вообще не имеет симптомов. У некоторых есть боли в животе и водянистые, зловонные диарея, которая может привести к обезвоживанию. У них также может быть чрезмерное газообразование и вздутие живота, а также плохой аппетит, что приводит к потере веса.Лихорадка бывает редко. Чаще всего симптомы проявляются через 7–14 дней после заражения. Giardia и может длиться без лечения от 4 до 6 недель.

    Как ставится диагноз?

    Образец стула вашего ребенка будет проверен на наличие Лямблии кишечные .

    Лечение

    Чтобы ваш ребенок хорошо увлажнялся, он должен пить много жидкости, рекомендованной вашим педиатром, например растворы для пероральной регидратации, отпускаемые без рецепта или приготовленные в домашних условиях.Ваш врач может также назначить лекарства, отпускаемые по рецепту (чаще всего метронидазол, фуразолидон или нитазоксанид), которые в большинстве случаев излечивают после 5–7 дней лечения. Если у вашего ребенка в кале обнаружены микроорганизмы Giardia, но симптомы отсутствуют, лечение не требуется.

    Профилактика

    • Когда ребенок посещает детский сад, родители должны убедиться, что сотрудники соблюдают правила гигиены и поощряют детей часто мыть руки с мылом и водой.
    • Игрушки, которые ребенок кладет в рот, следует вымыть и продезинфицировать, прежде чем с ними начнет играть другой ребенок.
    • Перед употреблением сырые фрукты и овощи рекомендуется мыть и очищать от кожуры.
    • Детям следует избегать употребления неочищенной воды из ручьев, озер, рек и прудов.
    • Берите бутилированную воду в походы или кипятите, фильтруйте и обрабатывайте питьевую воду химическими таблетками перед ее употреблением.

    Информация, содержащаяся на этом веб-сайте, не должна использоваться в качестве замены медицинской помощи и рекомендаций вашего педиатра. Могут быть варианты лечения, которые ваш педиатр может порекомендовать в зависимости от индивидуальных фактов и обстоятельств.

    Похожие записи

    При гормональном сбое можно ли похудеть: как похудеть при гормональном сбое

    Содержание Как похудеть после гормональных таблетокЧто такое гормональные таблеткиПочему прием гормонов ведет к избыточному весу (adsbygoogle = window.adsbygoogle || []).push({}); […]

    Гипотензивные средства при гиперкалиемии: Гипотензивные средства при гиперкалиемии — Давление и всё о нём

    Содержание Препараты, применяемые для лечения гипертонической болезни | Илларионова Т.С., Стуров Н.В., Чельцов В.В.Основные принципы антигипертензивной терапииКлассификация Агонисты имидазолиновых I1–рецепторов […]

    Прикорм таблица детей до года: Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственном

    Содержание Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственномКогда можно и нужно вводить прикорм грудничку?Почему […]

    Добавить комментарий

    Ваш адрес email не будет опубликован.