Микроклизмы с облепиховым маслом: МИКРОКЛИЗМЫ С ОТВАРАМИ ТРАВ И ОБЛЕПИХОВЫМ МАСЛОМ

alexxlab Разное

Содержание

МИКРОКЛИЗМЫ С ОТВАРАМИ ТРАВ И ОБЛЕПИХОВЫМ МАСЛОМ

Техника проведения микроклизмы. В первую очередь готовится отвар из трав на облепиховом масле. Какие травы лучше? На это вопрос нельзя ответить однозначно, потому что каждый организмы индивидуален. Наиболее распространенные травы, это ромашка, полынь, лавровый лист, алоэ, лопух и даже листья свеклы. Все эти травы снимают боль, жжение, залечивают микротравмы, улучшают кровообращение и препятствуют размножению микроорганизмов. Облепиховое масло восстанавливает поврежденные ткани, обладает защитными свойствами и снимает воспаление уже при первом приеме. В зависимости от того, какую траву или корень вы выбрали, делается отвар.

При постановке микроклизмы пациент ложится на левый бок, колени максимально приближает к животу. Врач или медсестра раздвигает левой рукой ягодицы и вводит спринцовку, предварительно смазанную вазелином, в прямую кишку на 5-10 см. Вводить нужно аккуратно, медленно, вращательными движениями. После того, как спринцовка окажется в прямой кишке, правой рукой нужно медленно нажать на грушу и ввести лекарственное средство. Затем также аккуратно необходимо вытащить спринцовку. Пациент должен полежать с лекарством 10-15 минут, стараясь его удержать.

Показания к проведению данной процедуры

1.Геморрой;

2.Заболевания кишечника и желудка;

3.Заболевание слизистой прямой кишки;

4.Некоторые другие патологии.

Противопоказания

1.Слабость;

2.Повышенная температура тела;

3.Опухоли в прямой кишке;

4.Сильный воспалительный процесс;

5.Сильное кровотечение;

6.Сердечно – сосудистая недостаточность.

Курс лечения зависит от степени поражения, но чаще всего хватает поставить микроклизму 8-10 дней. Перед постановкой необходимо опорожнить кишечник и стараться не есть много пищи, содержащей клетчатку. Положительный эффект от процедуры будет заметен уже на 1-3 сутки. Если лечение проведено правильно, то рецидивов может больше не быть.

Санатории где применяется МИКРОКЛИЗМЫ С ОТВАРАМИ ТРАВ И ОБЛЕПИХОВЫМ МАСЛОМ:

Кисловодск: Виктория, Вилла Арнест, Джинал, Долина Нарзанов, Заря, Им. Димитрова, Им. Кирова, Им. Орджоникидзе, Им. Семашко, Кавказ, Красные Камни, Москва, Нарзан, Пикет, Плаза, Родник, Солнечный, Целебный Нарзан, Центросоюз.

Ессентуки: Виктория, Долина Нарзанов, Жемчужина Кавказа, Им. Анджиевского, Им. Сеченова, Им. Центросоюза, Исток, Металлург, Русь, Украина, Целебный Ключ, Шахтер.

Пятигорск: Дон, Зори Ставрополья, Им. Кирова, Ленинские Скалы, Машук, Пятигорский Нарзан,  Тарханы.

Железноводск: Буковая Роща, Горный Воздух, Дубовая Роща, Дубрава, Им. 30-летия Победы, Им. Тельмана, Лесной, Машук Аква-Терм, Минеральные Воды, Плаза, Эльбрус

Облепиховое масло: лечебные свойства и противопоказания.

О лечебных свойствах Облепихи крушиновидной (Hippophae rhamnoides) было известно с незапамятных времен, и современная научная медицина взяла на вооружение опыт наших предков — ягоды “сибирского ананаса” (так в народе часто называют облепиху) включены в реестр лекарственного сырья.

Хотя заготовка ягод облепихи — довольно трудоемкий процесс, тем не менее, объемы облепихового масла — ценного лекарственного препарата, обладающего уникальными свойствами — увеличиваются ежегодно.

Лечебные свойства облепихового масла

Облепиховое масло активизирует процессы регенерации тканей и усиливает рост грануляций и возобновление эпителиального слоя, поэтому оказывает ранозаживляющее действие. Препарат также способствует ослаблению болевых ощущений.

Масло облепихи — один из немногих препаратов, которые оказались эффективными в профилактике и лечении лучевых поражений кожи. Тактика лечения состоит в следующем: на изъязвленных участках кожи в течение нескольких дней проводят обработку антибиотиками, очищая от некротических наростов (толстые налеты срезают ножницами или скальпелем), предварительно проведя местную анестезию для уменьшения болевых ощущений. После очистки пораженных участков на них наносят облепиховое масло с наложением марлевой повязки (их заменяют ежедневно, или же через день, в зависимости от степени поражения). Продолжительность лечения зависит от скорости грануляции язвенной поверхности.

При лечении заболеваний кожи (в том числе и травматических повреждений) для усиления лечебного эффекта облепиховое масло сочетают с каротином (по 1,5 – 2 мг на 1 мл масла). Кроме наружного использования, облепиховое масло с каротином также дают перорально или в виде внутримышечных инъекций. Такая методика оказалась более эффективной в сравнении с традиционными способами лечения каротином при некоторых заболеваниях (язвенная волчанка, болезнь Дарье, экзема, чешуйчатый лишай, нейродермиты и пр.). Облепиховая мазь (5%-ная) способствует быстрому уменьшению отека и ускорению рассасывания инфильтрата.

Облепиховое масло используется и для внутреннего употребления с целью лечения и профилактики заболеваний желудочно-кишечного тракта. Систематическое употребление облепихового масла оказывает положительное влияние на секреторные функции поджелудочной железы и желудка, при этом приходят в норму пищеварительные процессы, происходит усиление моторно-эвакуационной функции кишечника, нормализуется липидный обмен в тканях печени, восстанавливается паренхима, разрушенная от частых возлияний алкоголя и пагубного воздействия токсинов. Облепиховое масло оказывает благоприятное воздействие на слизистую оболочку желудка и кишечника, при этом происходит эпителизация поврежденной поверхности. Нередко масло облепихи рекомендуют для комплексного лечения гастритов, язвенной болезни 12-типерстной кишки и желудка, колитов, энтероколитов и пр.

Облепиховое масло также оказывает существенную помощь при лечении заболеваний женской половой сферы, сопровождающихся эрозивно-язвенными процессами (эрозия шейки матки, эндометрит, кольпиты, в том числе и инфекционного характера, травматические повреждения слизистой оболочки и пр.).

Приготовление облепихового масла в домашних условиях

Облепиховое масло можно приобрести в аптечной сети, где препарат отпускается без рецепта, но его реально приготовить и в домашних условиях, при наличии источника сырья, а также некоторого запаса терпения.

Способ приготовления №1. Заготовленные плоды (ягоды) облепихи необходимо отсортировать (удалить порченые), промыть в проточной воде, просушить от остатков влаги на открытом воздухе, после чего пропустить через соковыжималку. Внимание! Цель — получение плодовой массы, но не сока, поэтому нельзя использовать скороварку, а исключительно механическую соковыжималку (ягоды можно протереть через сито — об этом будет рассказано при описании способа №2)! Полученную плодовую массу (жом) необходимо быстро высушить, для чего удобно использовать духовку, в которой поддерживать температуру в пределах 50 – 60 °C. Сушить жом при более высокой температуре, или же на солнце — категорически недопустимо, так как в этом случае произойдет разрушение биологически активных веществ и сырье потеряет лечебные свойства. Очевидно, что при переработке получится некоторое количество облепихового сока, поэтому его необходимо отстаивать несколько дней, пока жидкость не разделится на 2 слоя — вверху собирается масло. Маслянистый слой отделяют от водного и также высушивают в духовом шкафу. Высушенный маслянистый слой добавляют к сухому жому и пропускают через мясорубку, чтобы получить хорошо измельченную плодовую массу. С этого момента начинается довольно утомительный процесс получения облепихового масла, поэтому стоит запастись терпением. Масло облепихи получают по методу “многоступенчатой мацерации”, то есть извлечения (настаивания) при помощи инертных жиров. При промышленном производстве получают 1 кг облепихового масла из 20 – 25 кг свежих ягод — эти расчеты можно взять за основу при получении препарата в домашних условиях. Суть технологии “многоступенчатой мацерации” состоит в многократном насыщении (обогащении) масла-растворителя. Небольшую порцию плодового жома заливают растительным маслом (предпочтительно использовать оливковое; подсолнечное — крайний вариант) и выдерживают примерно 2 часа при повышенной температуре (60 – 65 °C). Обработанную порцию жома пропускают через соковыжималку, чтобы отделить жирное масло, а остаток отжимают при помощи ручного пресса. Использованный жом выбрасывается, а отжатое растительное масло используется для настаивания следующей порции плодовой массы. Постепенно, по мере обогащения, растительное масло приобретает красно-оранжевый цвет. После переработки всей плодовой массы получается “облепиховое масло”, то есть обогащенное инертное растительное масло.

Способ приготовления №2. Предварительную подготовку ягод облепихи проводят так же, как и при приготовлении масла по способу №1, после чего сырье протирают через мелкое сито. Оставшийся на сите жмых высушивают и сохраняют в стеклянных банках, закрытых пластмассовыми крышками. Протертую массу пастеризуют при 80 – 90 °Cи укупоривают в стеклянные банки. Через 2 – 3 месяца законсервированные банки вскрывают и вычерпывают верхний слой, в котором содержится до 25% облепихового масла. Снятый верхний слой смешивают с сохраненным жомом и заливают экстрагентом (оливковым маслом), предварительно нагретым до 60 – 70 °Cиз расчета 500 г плодовой массы на 1 литр. Далее необходимо поддерживать температуру экстрагента в пределах 60 – 70 °Cв течение 48-ми часов. Через 2-е суток массу выливают в полотняные мешочки, которые подвешивают над емкостью для сбора масла. Обогащенное жирное масло отделяется от плодовой массы и стекает в приемник (емкость).

Каждый из предложенных способов получения облепихового масла имеет, как недостатки, так и преимущества.

Составные препараты на основе облепихового масла (1)

Облепиховое масло с каротолином (2) или маслом шиповника. Смесь в соотношении 1:1 используется для наружного применения при лечении трещин сосков, трофических язв, ожогов, дерматозов. Клизмы с препаратом рекомендуются в случае неспецифического язвенного колита.

Облепиховое и зверобойное масло. Эта лечебная смесь применяется в стоматологической практике для лечения хронических и острых гингивитов и стоматитов. В отличие от ратании, применяемой с этими же целями, зверобой не раздражает слизистую.

Сочетание с календулой. Из цветков календулы можно приготовить масляный экстракт методом мацерации, наподобие получения облепихового масла. Составной препарат используется в гинекологической практике для тампонажа при лечении эрозии шейки матки, трихомонадного кольпита и пр. Внутрь препарат применяется при язве желудка и 12-типерстной кишки. Наружно смесь используется для лечения ожогов, гангренозных язв, обморожений, мастита и пр.

Облепиховое масло в лечении ЖКТ

Внутреннее применение облепихового масла рекомендуется в комплексном лечении гастритов, язвенной болезни желудка и 12-типерстной кишки. При указанных заболеваниях масло назначается по 1 ч.л. перед едой (за 15 – 20 минут перед приемом пищи). Продолжительность курса лечения составляет примерно от 3 до 4-х недель (в зависимости от полученного лечебного эффекта).

Язва желудка. Народные целители рекомендуют проводить лечение по следующей методике:

1. Необходимо точно знать месторасположение язвы (на передней стенке желудка, на задней, справа-слева) — это можно выяснить при проведении эндоскопии.
2. Трижды в день (утром, в обед и перед ужином) выпить 1 ст.л. облепихового масла и лечь в кровать на ту сторону, где обнаружена локализация язвы (лежать 45 – 60 минут).
3. Курс лечения составляет 3 – 4 недели.
4. В период лечения соблюдать рекомендованную диету, полный отказ от спиртного и курения!

С целью профилактики масло облепихи назначают внутрь при проведении лучевой терапии при лечении злокачественных опухолей пищевода. Принимают масло по 1,5 – 2 ч.л. трижды в день на протяжении всего курса лучевой терапии, а также еще в течение от 2-х до 4-х недель после окончания процедур.

Облепиховое масло в лечении женской половой сферы

Эрозии шейки матки. При лечении эрозии облепиховое масло применяют в виде тампонов, пропитанных препаратом, которые вводят во влагалище на ночь. Предварительно необходимо спринцевание раствором календулы (на 1 стакан теплой кипяченой воды — 1 ч.л. спиртовой настойки ноготков). Кроме эрозии, по аналогичной методике проводят лечение в случае кольпитов и при эндоцервицитах. Лечение курсовое — в среднем по 10 – 15 процедур, проводимых ежедневно без перерыва. В силу различных причин лечение может оказаться малоэффективным — в этом случае необходимо сделать перерыв на полтора – два месяца, после чего пройти повторный курс. Известны случаи лечения облепиховым маслом (тампонаж в течение 50-ти дней) фибромиом, которые планировалось удалить оперативным путем.

Частные случаи применения облепихового масла

Гайморит. Для лечения рекомендуется вводить в гайморовы пазухи по 5 мл облепихового масла (стерильного). Такие процедуры проводятся дважды в день под наблюдением специалиста.

Стоматологические проблемы. При пародонтозе, гингивитах, стоматитах и прочих проблемах, которые относятся к сфере стоматологии, рекомендуется провести курс аппликаций с использованием облепихового масла. Пропитанные препаратом марлевые (ватные) жгуты прикладывать к пораженным деснам. Продолжительность процедуры составляет 10-15 минут.

Храп. Ночной храп нередко мешает окружающим, а происходит это явление по причине высыхания слизистой оболочки носовых пазух. Чтобы не беспокоить окружающих храпом, можно попробовать закапать перед сном по 1 капле облепихового масла в каждую ноздрю — часто помогает.

Геморрой. Для лечения геморроя и прочих проктологических проблем (анальные трещины, свищи и др.) рекомендуется делать микроклизмы с облепиховым маслом и каротолином (в соотношении 1:1). Кроме микроклизм необходимо несколько раз в сутки ставить компрессы с облепиховым маслом или смесью с каротолином. Продолжительность процедуры составляет от 1 до 2-х часов. Для повышения эффективности лечения рекомендуется сочетать наружное применение и пероральное употребление облепихового масла (по 1 ч.л. 1 – 2 раза в день).

Экзема. При лечении сочетают наружное применение облепихового масла и прием препарата внутрь (по 2 – 3 мл). Для смазывания пораженных участков кожи лучше использовать 5%-ную мазь, которую можно приобрести в аптечной сети.

Пролежни. У лежачих больных нередко появляются пролежни — раны на коже. Для лечения пролежней народные целители рекомендуют использовать раствор шампуня в водке (на пол-литра водки — 6 ст.л. шампуня) и облепиховое масло. Раствором шампуня обрабатывают пораженные участки кожи, а затем наносят слой облепихового масла (можно использовать 5%-ную мазь).

Ожоги. Тяжелые ожоги (от электрической дуги, кислотами или щелочами) трудно поддаются лечению обычным способом. Рецепт мази, приведенной ниже, позаимствован из практики народных целителей. Для приготовления необходимо взять пол-литра известковой воды, довести до кипения и влить 200 мл подсолнечного масла. Варить смесь в течение 3-х часов, после чего добавить по 50 г свиного смальца и бараньего жира, кусочек прополиса (размером с половину спичечного коробка) и столько же желтого воска. Когда ингредиенты расплавятся, массу снять с огня и добавить по 5 таблеток Анальгина и Стрептоцида (предварительно растолочь в порошок), флакон пенициллина и 2 ампулы Новокаина (Лидокаин или другой препарат, использующийся для анестезии), плюс 50 мл облепихового масла. Смесь энергично перемешать. Когда масса остынет, вверху соберется слой мази, который необходимо снять и переложить в стеклянную баночку. Жидкость также используется для лечения, только в ней необходимо растворить 3 яичных белка и 6 ампул активированного сока алоэ (продается в аптечной сети; препарат отпускается без рецепта). Известковая вода используется для промывания раневой поверхности и отмачивания присохших бинтов. Мазь применяют для компрессов. Известковую воду и мазь применяют до тех пор, пока не образуется грануляция по всей раневой поверхности, после чего лечение продолжают с использованием компрессов из облепихового масла или 5%-ной мази.

Простатит. Рецепт караимов (народность, проживающая на юге Украины). Для приготовления ректальных суппозиториев потребуется: облепиховое масло — 150 мл; по 30 г плодов аниса и молодых листьев березы. Семена аниса и березовые листья предварительно высушить и перемолоть в мельчайший порошок, чтобы не травмировать слизистую прямой кишки. Для получения необходимой вязкости нужно добавить пчелиный воск (облепиховое масло предварительно разогреть на водяной бане). Применяют лечебные суппозитории, как правило, 2 – 3 раза в сутки, вплоть до полного излечения.

Противопоказания и побочное действие

Противопоказаний для наружного применения облепихового масла не выявлено. Аллергические реакции при приеме масла внутрь встречаются крайне редко. При использовании его перорально (внутрь) следует учитывать, что для некоторых заболеваний такое применение может быть противопоказано. Облепиховое масло не рекомендуется использовать для лечения во время обострения воспалительных процессов в желчном пузыре, поджелудочной или печени.

Врачебная консультация — наиболее правильное решение, которое поможет избежать неожиданностей во время лечения при помощи облепихового масла.

Примечания

1. Сочетания не имеют противопоказаний в случае лечения указанных заболеваний.

2. Каротолин — масляный экстракт из мякоти плодов шиповника. Приготовление препарата в домашних условиях сходно с получением облепихового масла. Каротолин применяется для лечения экземы, трофических язв, ран и других травматических повреждений кожи.

Облепиховое масло: лечебные свойства и противопоказания.

О лечебных свойствах Облепихи крушиновидной (Hippophae rhamnoides) было известно с незапамятных времен, и современная научная медицина взяла на вооружение опыт наших предков — ягоды “сибирского ананаса” (так в народе часто называют облепиху) включены в реестр лекарственного сырья.

Хотя заготовка ягод облепихи — довольно трудоемкий процесс, тем не менее, объемы облепихового масла — ценного лекарственного препарата, обладающего уникальными свойствами — увеличиваются ежегодно.

Лечебные свойства облепихового масла

Облепиховое масло активизирует процессы регенерации тканей и усиливает рост грануляций и возобновление эпителиального слоя, поэтому оказывает ранозаживляющее действие. Препарат также способствует ослаблению болевых ощущений.

Масло облепихи — один из немногих препаратов, которые оказались эффективными в профилактике и лечении лучевых поражений кожи. Тактика лечения состоит в следующем: на изъязвленных участках кожи в течение нескольких дней проводят обработку антибиотиками, очищая от некротических наростов (толстые налеты срезают ножницами или скальпелем), предварительно проведя местную анестезию для уменьшения болевых ощущений. После очистки пораженных участков на них наносят облепиховое масло с наложением марлевой повязки (их заменяют ежедневно, или же через день, в зависимости от степени поражения). Продолжительность лечения зависит от скорости грануляции язвенной поверхности.

При лечении заболеваний кожи (в том числе и травматических повреждений) для усиления лечебного эффекта облепиховое масло сочетают с каротином (по 1,5 – 2 мг на 1 мл масла). Кроме наружного использования, облепиховое масло с каротином также дают перорально или в виде внутримышечных инъекций. Такая методика оказалась более эффективной в сравнении с традиционными способами лечения каротином при некоторых заболеваниях (язвенная волчанка, болезнь Дарье, экзема, чешуйчатый лишай, нейродермиты и пр.). Облепиховая мазь (5%-ная) способствует быстрому уменьшению отека и ускорению рассасывания инфильтрата.

Облепиховое масло используется и для внутреннего употребления с целью лечения и профилактики заболеваний желудочно-кишечного тракта. Систематическое употребление облепихового масла оказывает положительное влияние на секреторные функции поджелудочной железы и желудка, при этом приходят в норму пищеварительные процессы, происходит усиление моторно-эвакуационной функции кишечника, нормализуется липидный обмен в тканях печени, восстанавливается паренхима, разрушенная от частых возлияний алкоголя и пагубного воздействия токсинов. Облепиховое масло оказывает благоприятное воздействие на слизистую оболочку желудка и кишечника, при этом происходит эпителизация поврежденной поверхности. Нередко масло облепихи рекомендуют для комплексного лечения гастритов, язвенной болезни 12-типерстной кишки и желудка, колитов, энтероколитов и пр.

Облепиховое масло также оказывает существенную помощь при лечении заболеваний женской половой сферы, сопровождающихся эрозивно-язвенными процессами (эрозия шейки матки, эндометрит, кольпиты, в том числе и инфекционного характера, травматические повреждения слизистой оболочки и пр.).

Приготовление облепихового масла в домашних условиях

Облепиховое масло можно приобрести в аптечной сети, где препарат отпускается без рецепта, но его реально приготовить и в домашних условиях, при наличии источника сырья, а также некоторого запаса терпения.

Способ приготовления №1. Заготовленные плоды (ягоды) облепихи необходимо отсортировать (удалить порченые), промыть в проточной воде, просушить от остатков влаги на открытом воздухе, после чего пропустить через соковыжималку. Внимание! Цель — получение плодовой массы, но не сока, поэтому нельзя использовать скороварку, а исключительно механическую соковыжималку (ягоды можно протереть через сито — об этом будет рассказано при описании способа №2)! Полученную плодовую массу (жом) необходимо быстро высушить, для чего удобно использовать духовку, в которой поддерживать температуру в пределах 50 – 60 °C. Сушить жом при более высокой температуре, или же на солнце — категорически недопустимо, так как в этом случае произойдет разрушение биологически активных веществ и сырье потеряет лечебные свойства. Очевидно, что при переработке получится некоторое количество облепихового сока, поэтому его необходимо отстаивать несколько дней, пока жидкость не разделится на 2 слоя — вверху собирается масло. Маслянистый слой отделяют от водного и также высушивают в духовом шкафу. Высушенный маслянистый слой добавляют к сухому жому и пропускают через мясорубку, чтобы получить хорошо измельченную плодовую массу. С этого момента начинается довольно утомительный процесс получения облепихового масла, поэтому стоит запастись терпением. Масло облепихи получают по методу “многоступенчатой мацерации”, то есть извлечения (настаивания) при помощи инертных жиров. При промышленном производстве получают 1 кг облепихового масла из 20 – 25 кг свежих ягод — эти расчеты можно взять за основу при получении препарата в домашних условиях. Суть технологии “многоступенчатой мацерации” состоит в многократном насыщении (обогащении) масла-растворителя. Небольшую порцию плодового жома заливают растительным маслом (предпочтительно использовать оливковое; подсолнечное — крайний вариант) и выдерживают примерно 2 часа при повышенной температуре (60 – 65 °C). Обработанную порцию жома пропускают через соковыжималку, чтобы отделить жирное масло, а остаток отжимают при помощи ручного пресса. Использованный жом выбрасывается, а отжатое растительное масло используется для настаивания следующей порции плодовой массы. Постепенно, по мере обогащения, растительное масло приобретает красно-оранжевый цвет. После переработки всей плодовой массы получается “облепиховое масло”, то есть обогащенное инертное растительное масло.

Способ приготовления №2. Предварительную подготовку ягод облепихи проводят так же, как и при приготовлении масла по способу №1, после чего сырье протирают через мелкое сито. Оставшийся на сите жмых высушивают и сохраняют в стеклянных банках, закрытых пластмассовыми крышками. Протертую массу пастеризуют при 80 – 90 °Cи укупоривают в стеклянные банки. Через 2 – 3 месяца законсервированные банки вскрывают и вычерпывают верхний слой, в котором содержится до 25% облепихового масла. Снятый верхний слой смешивают с сохраненным жомом и заливают экстрагентом (оливковым маслом), предварительно нагретым до 60 – 70 °Cиз расчета 500 г плодовой массы на 1 литр. Далее необходимо поддерживать температуру экстрагента в пределах 60 – 70 °Cв течение 48-ми часов. Через 2-е суток массу выливают в полотняные мешочки, которые подвешивают над емкостью для сбора масла. Обогащенное жирное масло отделяется от плодовой массы и стекает в приемник (емкость).

Каждый из предложенных способов получения облепихового масла имеет, как недостатки, так и преимущества.

Составные препараты на основе облепихового масла (1)

Облепиховое масло с каротолином (2) или маслом шиповника. Смесь в соотношении 1:1 используется для наружного применения при лечении трещин сосков, трофических язв, ожогов, дерматозов. Клизмы с препаратом рекомендуются в случае неспецифического язвенного колита.

Облепиховое и зверобойное масло. Эта лечебная смесь применяется в стоматологической практике для лечения хронических и острых гингивитов и стоматитов. В отличие от ратании, применяемой с этими же целями, зверобой не раздражает слизистую.

Сочетание с календулой. Из цветков календулы можно приготовить масляный экстракт методом мацерации, наподобие получения облепихового масла. Составной препарат используется в гинекологической практике для тампонажа при лечении эрозии шейки матки, трихомонадного кольпита и пр. Внутрь препарат применяется при язве желудка и 12-типерстной кишки. Наружно смесь используется для лечения ожогов, гангренозных язв, обморожений, мастита и пр.

Облепиховое масло в лечении ЖКТ

Внутреннее применение облепихового масла рекомендуется в комплексном лечении гастритов, язвенной болезни желудка и 12-типерстной кишки. При указанных заболеваниях масло назначается по 1 ч.л. перед едой (за 15 – 20 минут перед приемом пищи). Продолжительность курса лечения составляет примерно от 3 до 4-х недель (в зависимости от полученного лечебного эффекта).

Язва желудка. Народные целители рекомендуют проводить лечение по следующей методике:

1. Необходимо точно знать месторасположение язвы (на передней стенке желудка, на задней, справа-слева) — это можно выяснить при проведении эндоскопии.
2. Трижды в день (утром, в обед и перед ужином) выпить 1 ст.л. облепихового масла и лечь в кровать на ту сторону, где обнаружена локализация язвы (лежать 45 – 60 минут).
3. Курс лечения составляет 3 – 4 недели.
4. В период лечения соблюдать рекомендованную диету, полный отказ от спиртного и курения!

С целью профилактики масло облепихи назначают внутрь при проведении лучевой терапии при лечении злокачественных опухолей пищевода. Принимают масло по 1,5 – 2 ч.л. трижды в день на протяжении всего курса лучевой терапии, а также еще в течение от 2-х до 4-х недель после окончания процедур.

Облепиховое масло в лечении женской половой сферы

Эрозии шейки матки. При лечении эрозии облепиховое масло применяют в виде тампонов, пропитанных препаратом, которые вводят во влагалище на ночь. Предварительно необходимо спринцевание раствором календулы (на 1 стакан теплой кипяченой воды — 1 ч.л. спиртовой настойки ноготков). Кроме эрозии, по аналогичной методике проводят лечение в случае кольпитов и при эндоцервицитах. Лечение курсовое — в среднем по 10 – 15 процедур, проводимых ежедневно без перерыва. В силу различных причин лечение может оказаться малоэффективным — в этом случае необходимо сделать перерыв на полтора – два месяца, после чего пройти повторный курс. Известны случаи лечения облепиховым маслом (тампонаж в течение 50-ти дней) фибромиом, которые планировалось удалить оперативным путем.

Частные случаи применения облепихового масла

Гайморит. Для лечения рекомендуется вводить в гайморовы пазухи по 5 мл облепихового масла (стерильного). Такие процедуры проводятся дважды в день под наблюдением специалиста.

Стоматологические проблемы. При пародонтозе, гингивитах, стоматитах и прочих проблемах, которые относятся к сфере стоматологии, рекомендуется провести курс аппликаций с использованием облепихового масла. Пропитанные препаратом марлевые (ватные) жгуты прикладывать к пораженным деснам. Продолжительность процедуры составляет 10-15 минут.

Храп. Ночной храп нередко мешает окружающим, а происходит это явление по причине высыхания слизистой оболочки носовых пазух. Чтобы не беспокоить окружающих храпом, можно попробовать закапать перед сном по 1 капле облепихового масла в каждую ноздрю — часто помогает.

Геморрой. Для лечения геморроя и прочих проктологических проблем (анальные трещины, свищи и др.) рекомендуется делать микроклизмы с облепиховым маслом и каротолином (в соотношении 1:1). Кроме микроклизм необходимо несколько раз в сутки ставить компрессы с облепиховым маслом или смесью с каротолином. Продолжительность процедуры составляет от 1 до 2-х часов. Для повышения эффективности лечения рекомендуется сочетать наружное применение и пероральное употребление облепихового масла (по 1 ч.л. 1 – 2 раза в день).

Экзема. При лечении сочетают наружное применение облепихового масла и прием препарата внутрь (по 2 – 3 мл). Для смазывания пораженных участков кожи лучше использовать 5%-ную мазь, которую можно приобрести в аптечной сети.

Пролежни. У лежачих больных нередко появляются пролежни — раны на коже. Для лечения пролежней народные целители рекомендуют использовать раствор шампуня в водке (на пол-литра водки — 6 ст.л. шампуня) и облепиховое масло. Раствором шампуня обрабатывают пораженные участки кожи, а затем наносят слой облепихового масла (можно использовать 5%-ную мазь).

Ожоги. Тяжелые ожоги (от электрической дуги, кислотами или щелочами) трудно поддаются лечению обычным способом. Рецепт мази, приведенной ниже, позаимствован из практики народных целителей. Для приготовления необходимо взять пол-литра известковой воды, довести до кипения и влить 200 мл подсолнечного масла. Варить смесь в течение 3-х часов, после чего добавить по 50 г свиного смальца и бараньего жира, кусочек прополиса (размером с половину спичечного коробка) и столько же желтого воска. Когда ингредиенты расплавятся, массу снять с огня и добавить по 5 таблеток Анальгина и Стрептоцида (предварительно растолочь в порошок), флакон пенициллина и 2 ампулы Новокаина (Лидокаин или другой препарат, использующийся для анестезии), плюс 50 мл облепихового масла. Смесь энергично перемешать. Когда масса остынет, вверху соберется слой мази, который необходимо снять и переложить в стеклянную баночку. Жидкость также используется для лечения, только в ней необходимо растворить 3 яичных белка и 6 ампул активированного сока алоэ (продается в аптечной сети; препарат отпускается без рецепта). Известковая вода используется для промывания раневой поверхности и отмачивания присохших бинтов. Мазь применяют для компрессов. Известковую воду и мазь применяют до тех пор, пока не образуется грануляция по всей раневой поверхности, после чего лечение продолжают с использованием компрессов из облепихового масла или 5%-ной мази.

Простатит. Рецепт караимов (народность, проживающая на юге Украины). Для приготовления ректальных суппозиториев потребуется: облепиховое масло — 150 мл; по 30 г плодов аниса и молодых листьев березы. Семена аниса и березовые листья предварительно высушить и перемолоть в мельчайший порошок, чтобы не травмировать слизистую прямой кишки. Для получения необходимой вязкости нужно добавить пчелиный воск (облепиховое масло предварительно разогреть на водяной бане). Применяют лечебные суппозитории, как правило, 2 – 3 раза в сутки, вплоть до полного излечения.

Противопоказания и побочное действие

Противопоказаний для наружного применения облепихового масла не выявлено. Аллергические реакции при приеме масла внутрь встречаются крайне редко. При использовании его перорально (внутрь) следует учитывать, что для некоторых заболеваний такое применение может быть противопоказано. Облепиховое масло не рекомендуется использовать для лечения во время обострения воспалительных процессов в желчном пузыре, поджелудочной или печени.

Врачебная консультация — наиболее правильное решение, которое поможет избежать неожиданностей во время лечения при помощи облепихового масла.

Примечания

1. Сочетания не имеют противопоказаний в случае лечения указанных заболеваний.

2. Каротолин — масляный экстракт из мякоти плодов шиповника. Приготовление препарата в домашних условиях сходно с получением облепихового масла. Каротолин применяется для лечения экземы, трофических язв, ран и других травматических повреждений кожи.

Облепиховое масло: лечебные свойства и противопоказания.

О лечебных свойствах Облепихи крушиновидной (Hippophae rhamnoides) было известно с незапамятных времен, и современная научная медицина взяла на вооружение опыт наших предков — ягоды “сибирского ананаса” (так в народе часто называют облепиху) включены в реестр лекарственного сырья.

Хотя заготовка ягод облепихи — довольно трудоемкий процесс, тем не менее, объемы облепихового масла — ценного лекарственного препарата, обладающего уникальными свойствами — увеличиваются ежегодно.

Лечебные свойства облепихового масла

Облепиховое масло активизирует процессы регенерации тканей и усиливает рост грануляций и возобновление эпителиального слоя, поэтому оказывает ранозаживляющее действие. Препарат также способствует ослаблению болевых ощущений.

Масло облепихи — один из немногих препаратов, которые оказались эффективными в профилактике и лечении лучевых поражений кожи. Тактика лечения состоит в следующем: на изъязвленных участках кожи в течение нескольких дней проводят обработку антибиотиками, очищая от некротических наростов (толстые налеты срезают ножницами или скальпелем), предварительно проведя местную анестезию для уменьшения болевых ощущений. После очистки пораженных участков на них наносят облепиховое масло с наложением марлевой повязки (их заменяют ежедневно, или же через день, в зависимости от степени поражения). Продолжительность лечения зависит от скорости грануляции язвенной поверхности.

При лечении заболеваний кожи (в том числе и травматических повреждений) для усиления лечебного эффекта облепиховое масло сочетают с каротином (по 1,5 – 2 мг на 1 мл масла). Кроме наружного использования, облепиховое масло с каротином также дают перорально или в виде внутримышечных инъекций. Такая методика оказалась более эффективной в сравнении с традиционными способами лечения каротином при некоторых заболеваниях (язвенная волчанка, болезнь Дарье, экзема, чешуйчатый лишай, нейродермиты и пр.). Облепиховая мазь (5%-ная) способствует быстрому уменьшению отека и ускорению рассасывания инфильтрата.

Облепиховое масло используется и для внутреннего употребления с целью лечения и профилактики заболеваний желудочно-кишечного тракта. Систематическое употребление облепихового масла оказывает положительное влияние на секреторные функции поджелудочной железы и желудка, при этом приходят в норму пищеварительные процессы, происходит усиление моторно-эвакуационной функции кишечника, нормализуется липидный обмен в тканях печени, восстанавливается паренхима, разрушенная от частых возлияний алкоголя и пагубного воздействия токсинов. Облепиховое масло оказывает благоприятное воздействие на слизистую оболочку желудка и кишечника, при этом происходит эпителизация поврежденной поверхности. Нередко масло облепихи рекомендуют для комплексного лечения гастритов, язвенной болезни 12-типерстной кишки и желудка, колитов, энтероколитов и пр.

Облепиховое масло также оказывает существенную помощь при лечении заболеваний женской половой сферы, сопровождающихся эрозивно-язвенными процессами (эрозия шейки матки, эндометрит, кольпиты, в том числе и инфекционного характера, травматические повреждения слизистой оболочки и пр.).

Приготовление облепихового масла в домашних условиях

Облепиховое масло можно приобрести в аптечной сети, где препарат отпускается без рецепта, но его реально приготовить и в домашних условиях, при наличии источника сырья, а также некоторого запаса терпения.

Способ приготовления №1. Заготовленные плоды (ягоды) облепихи необходимо отсортировать (удалить порченые), промыть в проточной воде, просушить от остатков влаги на открытом воздухе, после чего пропустить через соковыжималку. Внимание! Цель — получение плодовой массы, но не сока, поэтому нельзя использовать скороварку, а исключительно механическую соковыжималку (ягоды можно протереть через сито — об этом будет рассказано при описании способа №2)! Полученную плодовую массу (жом) необходимо быстро высушить, для чего удобно использовать духовку, в которой поддерживать температуру в пределах 50 – 60 °C. Сушить жом при более высокой температуре, или же на солнце — категорически недопустимо, так как в этом случае произойдет разрушение биологически активных веществ и сырье потеряет лечебные свойства. Очевидно, что при переработке получится некоторое количество облепихового сока, поэтому его необходимо отстаивать несколько дней, пока жидкость не разделится на 2 слоя — вверху собирается масло. Маслянистый слой отделяют от водного и также высушивают в духовом шкафу. Высушенный маслянистый слой добавляют к сухому жому и пропускают через мясорубку, чтобы получить хорошо измельченную плодовую массу. С этого момента начинается довольно утомительный процесс получения облепихового масла, поэтому стоит запастись терпением. Масло облепихи получают по методу “многоступенчатой мацерации”, то есть извлечения (настаивания) при помощи инертных жиров. При промышленном производстве получают 1 кг облепихового масла из 20 – 25 кг свежих ягод — эти расчеты можно взять за основу при получении препарата в домашних условиях. Суть технологии “многоступенчатой мацерации” состоит в многократном насыщении (обогащении) масла-растворителя. Небольшую порцию плодового жома заливают растительным маслом (предпочтительно использовать оливковое; подсолнечное — крайний вариант) и выдерживают примерно 2 часа при повышенной температуре (60 – 65 °C). Обработанную порцию жома пропускают через соковыжималку, чтобы отделить жирное масло, а остаток отжимают при помощи ручного пресса. Использованный жом выбрасывается, а отжатое растительное масло используется для настаивания следующей порции плодовой массы. Постепенно, по мере обогащения, растительное масло приобретает красно-оранжевый цвет. После переработки всей плодовой массы получается “облепиховое масло”, то есть обогащенное инертное растительное масло.

Способ приготовления №2. Предварительную подготовку ягод облепихи проводят так же, как и при приготовлении масла по способу №1, после чего сырье протирают через мелкое сито. Оставшийся на сите жмых высушивают и сохраняют в стеклянных банках, закрытых пластмассовыми крышками. Протертую массу пастеризуют при 80 – 90 °Cи укупоривают в стеклянные банки. Через 2 – 3 месяца законсервированные банки вскрывают и вычерпывают верхний слой, в котором содержится до 25% облепихового масла. Снятый верхний слой смешивают с сохраненным жомом и заливают экстрагентом (оливковым маслом), предварительно нагретым до 60 – 70 °Cиз расчета 500 г плодовой массы на 1 литр. Далее необходимо поддерживать температуру экстрагента в пределах 60 – 70 °Cв течение 48-ми часов. Через 2-е суток массу выливают в полотняные мешочки, которые подвешивают над емкостью для сбора масла. Обогащенное жирное масло отделяется от плодовой массы и стекает в приемник (емкость).

Каждый из предложенных способов получения облепихового масла имеет, как недостатки, так и преимущества.

Составные препараты на основе облепихового масла (1)

Облепиховое масло с каротолином (2) или маслом шиповника. Смесь в соотношении 1:1 используется для наружного применения при лечении трещин сосков, трофических язв, ожогов, дерматозов. Клизмы с препаратом рекомендуются в случае неспецифического язвенного колита.

Облепиховое и зверобойное масло. Эта лечебная смесь применяется в стоматологической практике для лечения хронических и острых гингивитов и стоматитов. В отличие от ратании, применяемой с этими же целями, зверобой не раздражает слизистую.

Сочетание с календулой. Из цветков календулы можно приготовить масляный экстракт методом мацерации, наподобие получения облепихового масла. Составной препарат используется в гинекологической практике для тампонажа при лечении эрозии шейки матки, трихомонадного кольпита и пр. Внутрь препарат применяется при язве желудка и 12-типерстной кишки. Наружно смесь используется для лечения ожогов, гангренозных язв, обморожений, мастита и пр.

Облепиховое масло в лечении ЖКТ

Внутреннее применение облепихового масла рекомендуется в комплексном лечении гастритов, язвенной болезни желудка и 12-типерстной кишки. При указанных заболеваниях масло назначается по 1 ч.л. перед едой (за 15 – 20 минут перед приемом пищи). Продолжительность курса лечения составляет примерно от 3 до 4-х недель (в зависимости от полученного лечебного эффекта).

Язва желудка. Народные целители рекомендуют проводить лечение по следующей методике:

1. Необходимо точно знать месторасположение язвы (на передней стенке желудка, на задней, справа-слева) — это можно выяснить при проведении эндоскопии.
2. Трижды в день (утром, в обед и перед ужином) выпить 1 ст.л. облепихового масла и лечь в кровать на ту сторону, где обнаружена локализация язвы (лежать 45 – 60 минут).
3. Курс лечения составляет 3 – 4 недели.
4. В период лечения соблюдать рекомендованную диету, полный отказ от спиртного и курения!

С целью профилактики масло облепихи назначают внутрь при проведении лучевой терапии при лечении злокачественных опухолей пищевода. Принимают масло по 1,5 – 2 ч.л. трижды в день на протяжении всего курса лучевой терапии, а также еще в течение от 2-х до 4-х недель после окончания процедур.

Облепиховое масло в лечении женской половой сферы

Эрозии шейки матки. При лечении эрозии облепиховое масло применяют в виде тампонов, пропитанных препаратом, которые вводят во влагалище на ночь. Предварительно необходимо спринцевание раствором календулы (на 1 стакан теплой кипяченой воды — 1 ч.л. спиртовой настойки ноготков). Кроме эрозии, по аналогичной методике проводят лечение в случае кольпитов и при эндоцервицитах. Лечение курсовое — в среднем по 10 – 15 процедур, проводимых ежедневно без перерыва. В силу различных причин лечение может оказаться малоэффективным — в этом случае необходимо сделать перерыв на полтора – два месяца, после чего пройти повторный курс. Известны случаи лечения облепиховым маслом (тампонаж в течение 50-ти дней) фибромиом, которые планировалось удалить оперативным путем.

Частные случаи применения облепихового масла

Гайморит. Для лечения рекомендуется вводить в гайморовы пазухи по 5 мл облепихового масла (стерильного). Такие процедуры проводятся дважды в день под наблюдением специалиста.

Стоматологические проблемы. При пародонтозе, гингивитах, стоматитах и прочих проблемах, которые относятся к сфере стоматологии, рекомендуется провести курс аппликаций с использованием облепихового масла. Пропитанные препаратом марлевые (ватные) жгуты прикладывать к пораженным деснам. Продолжительность процедуры составляет 10-15 минут.

Храп. Ночной храп нередко мешает окружающим, а происходит это явление по причине высыхания слизистой оболочки носовых пазух. Чтобы не беспокоить окружающих храпом, можно попробовать закапать перед сном по 1 капле облепихового масла в каждую ноздрю — часто помогает.

Геморрой. Для лечения геморроя и прочих проктологических проблем (анальные трещины, свищи и др.) рекомендуется делать микроклизмы с облепиховым маслом и каротолином (в соотношении 1:1). Кроме микроклизм необходимо несколько раз в сутки ставить компрессы с облепиховым маслом или смесью с каротолином. Продолжительность процедуры составляет от 1 до 2-х часов. Для повышения эффективности лечения рекомендуется сочетать наружное применение и пероральное употребление облепихового масла (по 1 ч.л. 1 – 2 раза в день).

Экзема. При лечении сочетают наружное применение облепихового масла и прием препарата внутрь (по 2 – 3 мл). Для смазывания пораженных участков кожи лучше использовать 5%-ную мазь, которую можно приобрести в аптечной сети.

Пролежни. У лежачих больных нередко появляются пролежни — раны на коже. Для лечения пролежней народные целители рекомендуют использовать раствор шампуня в водке (на пол-литра водки — 6 ст.л. шампуня) и облепиховое масло. Раствором шампуня обрабатывают пораженные участки кожи, а затем наносят слой облепихового масла (можно использовать 5%-ную мазь).

Ожоги. Тяжелые ожоги (от электрической дуги, кислотами или щелочами) трудно поддаются лечению обычным способом. Рецепт мази, приведенной ниже, позаимствован из практики народных целителей. Для приготовления необходимо взять пол-литра известковой воды, довести до кипения и влить 200 мл подсолнечного масла. Варить смесь в течение 3-х часов, после чего добавить по 50 г свиного смальца и бараньего жира, кусочек прополиса (размером с половину спичечного коробка) и столько же желтого воска. Когда ингредиенты расплавятся, массу снять с огня и добавить по 5 таблеток Анальгина и Стрептоцида (предварительно растолочь в порошок), флакон пенициллина и 2 ампулы Новокаина (Лидокаин или другой препарат, использующийся для анестезии), плюс 50 мл облепихового масла. Смесь энергично перемешать. Когда масса остынет, вверху соберется слой мази, который необходимо снять и переложить в стеклянную баночку. Жидкость также используется для лечения, только в ней необходимо растворить 3 яичных белка и 6 ампул активированного сока алоэ (продается в аптечной сети; препарат отпускается без рецепта). Известковая вода используется для промывания раневой поверхности и отмачивания присохших бинтов. Мазь применяют для компрессов. Известковую воду и мазь применяют до тех пор, пока не образуется грануляция по всей раневой поверхности, после чего лечение продолжают с использованием компрессов из облепихового масла или 5%-ной мази.

Простатит. Рецепт караимов (народность, проживающая на юге Украины). Для приготовления ректальных суппозиториев потребуется: облепиховое масло — 150 мл; по 30 г плодов аниса и молодых листьев березы. Семена аниса и березовые листья предварительно высушить и перемолоть в мельчайший порошок, чтобы не травмировать слизистую прямой кишки. Для получения необходимой вязкости нужно добавить пчелиный воск (облепиховое масло предварительно разогреть на водяной бане). Применяют лечебные суппозитории, как правило, 2 – 3 раза в сутки, вплоть до полного излечения.

Противопоказания и побочное действие

Противопоказаний для наружного применения облепихового масла не выявлено. Аллергические реакции при приеме масла внутрь встречаются крайне редко. При использовании его перорально (внутрь) следует учитывать, что для некоторых заболеваний такое применение может быть противопоказано. Облепиховое масло не рекомендуется использовать для лечения во время обострения воспалительных процессов в желчном пузыре, поджелудочной или печени.

Врачебная консультация — наиболее правильное решение, которое поможет избежать неожиданностей во время лечения при помощи облепихового масла.

Примечания

1. Сочетания не имеют противопоказаний в случае лечения указанных заболеваний.

2. Каротолин — масляный экстракт из мякоти плодов шиповника. Приготовление препарата в домашних условиях сходно с получением облепихового масла. Каротолин применяется для лечения экземы, трофических язв, ран и других травматических повреждений кожи.

Облепиховое масло: лечебные свойства и противопоказания.

О лечебных свойствах Облепихи крушиновидной (Hippophae rhamnoides) было известно с незапамятных времен, и современная научная медицина взяла на вооружение опыт наших предков — ягоды “сибирского ананаса” (так в народе часто называют облепиху) включены в реестр лекарственного сырья.

Хотя заготовка ягод облепихи — довольно трудоемкий процесс, тем не менее, объемы облепихового масла — ценного лекарственного препарата, обладающего уникальными свойствами — увеличиваются ежегодно.

Лечебные свойства облепихового масла

Облепиховое масло активизирует процессы регенерации тканей и усиливает рост грануляций и возобновление эпителиального слоя, поэтому оказывает ранозаживляющее действие. Препарат также способствует ослаблению болевых ощущений.

Масло облепихи — один из немногих препаратов, которые оказались эффективными в профилактике и лечении лучевых поражений кожи. Тактика лечения состоит в следующем: на изъязвленных участках кожи в течение нескольких дней проводят обработку антибиотиками, очищая от некротических наростов (толстые налеты срезают ножницами или скальпелем), предварительно проведя местную анестезию для уменьшения болевых ощущений. После очистки пораженных участков на них наносят облепиховое масло с наложением марлевой повязки (их заменяют ежедневно, или же через день, в зависимости от степени поражения). Продолжительность лечения зависит от скорости грануляции язвенной поверхности.

При лечении заболеваний кожи (в том числе и травматических повреждений) для усиления лечебного эффекта облепиховое масло сочетают с каротином (по 1,5 – 2 мг на 1 мл масла). Кроме наружного использования, облепиховое масло с каротином также дают перорально или в виде внутримышечных инъекций. Такая методика оказалась более эффективной в сравнении с традиционными способами лечения каротином при некоторых заболеваниях (язвенная волчанка, болезнь Дарье, экзема, чешуйчатый лишай, нейродермиты и пр.). Облепиховая мазь (5%-ная) способствует быстрому уменьшению отека и ускорению рассасывания инфильтрата.

Облепиховое масло используется и для внутреннего употребления с целью лечения и профилактики заболеваний желудочно-кишечного тракта. Систематическое употребление облепихового масла оказывает положительное влияние на секреторные функции поджелудочной железы и желудка, при этом приходят в норму пищеварительные процессы, происходит усиление моторно-эвакуационной функции кишечника, нормализуется липидный обмен в тканях печени, восстанавливается паренхима, разрушенная от частых возлияний алкоголя и пагубного воздействия токсинов. Облепиховое масло оказывает благоприятное воздействие на слизистую оболочку желудка и кишечника, при этом происходит эпителизация поврежденной поверхности. Нередко масло облепихи рекомендуют для комплексного лечения гастритов, язвенной болезни 12-типерстной кишки и желудка, колитов, энтероколитов и пр.

Облепиховое масло также оказывает существенную помощь при лечении заболеваний женской половой сферы, сопровождающихся эрозивно-язвенными процессами (эрозия шейки матки, эндометрит, кольпиты, в том числе и инфекционного характера, травматические повреждения слизистой оболочки и пр.).

Приготовление облепихового масла в домашних условиях

Облепиховое масло можно приобрести в аптечной сети, где препарат отпускается без рецепта, но его реально приготовить и в домашних условиях, при наличии источника сырья, а также некоторого запаса терпения.

Способ приготовления №1. Заготовленные плоды (ягоды) облепихи необходимо отсортировать (удалить порченые), промыть в проточной воде, просушить от остатков влаги на открытом воздухе, после чего пропустить через соковыжималку. Внимание! Цель — получение плодовой массы, но не сока, поэтому нельзя использовать скороварку, а исключительно механическую соковыжималку (ягоды можно протереть через сито — об этом будет рассказано при описании способа №2)! Полученную плодовую массу (жом) необходимо быстро высушить, для чего удобно использовать духовку, в которой поддерживать температуру в пределах 50 – 60 °C. Сушить жом при более высокой температуре, или же на солнце — категорически недопустимо, так как в этом случае произойдет разрушение биологически активных веществ и сырье потеряет лечебные свойства. Очевидно, что при переработке получится некоторое количество облепихового сока, поэтому его необходимо отстаивать несколько дней, пока жидкость не разделится на 2 слоя — вверху собирается масло. Маслянистый слой отделяют от водного и также высушивают в духовом шкафу. Высушенный маслянистый слой добавляют к сухому жому и пропускают через мясорубку, чтобы получить хорошо измельченную плодовую массу. С этого момента начинается довольно утомительный процесс получения облепихового масла, поэтому стоит запастись терпением. Масло облепихи получают по методу “многоступенчатой мацерации”, то есть извлечения (настаивания) при помощи инертных жиров. При промышленном производстве получают 1 кг облепихового масла из 20 – 25 кг свежих ягод — эти расчеты можно взять за основу при получении препарата в домашних условиях. Суть технологии “многоступенчатой мацерации” состоит в многократном насыщении (обогащении) масла-растворителя. Небольшую порцию плодового жома заливают растительным маслом (предпочтительно использовать оливковое; подсолнечное — крайний вариант) и выдерживают примерно 2 часа при повышенной температуре (60 – 65 °C). Обработанную порцию жома пропускают через соковыжималку, чтобы отделить жирное масло, а остаток отжимают при помощи ручного пресса. Использованный жом выбрасывается, а отжатое растительное масло используется для настаивания следующей порции плодовой массы. Постепенно, по мере обогащения, растительное масло приобретает красно-оранжевый цвет. После переработки всей плодовой массы получается “облепиховое масло”, то есть обогащенное инертное растительное масло.

Способ приготовления №2. Предварительную подготовку ягод облепихи проводят так же, как и при приготовлении масла по способу №1, после чего сырье протирают через мелкое сито. Оставшийся на сите жмых высушивают и сохраняют в стеклянных банках, закрытых пластмассовыми крышками. Протертую массу пастеризуют при 80 – 90 °Cи укупоривают в стеклянные банки. Через 2 – 3 месяца законсервированные банки вскрывают и вычерпывают верхний слой, в котором содержится до 25% облепихового масла. Снятый верхний слой смешивают с сохраненным жомом и заливают экстрагентом (оливковым маслом), предварительно нагретым до 60 – 70 °Cиз расчета 500 г плодовой массы на 1 литр. Далее необходимо поддерживать температуру экстрагента в пределах 60 – 70 °Cв течение 48-ми часов. Через 2-е суток массу выливают в полотняные мешочки, которые подвешивают над емкостью для сбора масла. Обогащенное жирное масло отделяется от плодовой массы и стекает в приемник (емкость).

Каждый из предложенных способов получения облепихового масла имеет, как недостатки, так и преимущества.

Составные препараты на основе облепихового масла (1)

Облепиховое масло с каротолином (2) или маслом шиповника. Смесь в соотношении 1:1 используется для наружного применения при лечении трещин сосков, трофических язв, ожогов, дерматозов. Клизмы с препаратом рекомендуются в случае неспецифического язвенного колита.

Облепиховое и зверобойное масло. Эта лечебная смесь применяется в стоматологической практике для лечения хронических и острых гингивитов и стоматитов. В отличие от ратании, применяемой с этими же целями, зверобой не раздражает слизистую.

Сочетание с календулой. Из цветков календулы можно приготовить масляный экстракт методом мацерации, наподобие получения облепихового масла. Составной препарат используется в гинекологической практике для тампонажа при лечении эрозии шейки матки, трихомонадного кольпита и пр. Внутрь препарат применяется при язве желудка и 12-типерстной кишки. Наружно смесь используется для лечения ожогов, гангренозных язв, обморожений, мастита и пр.

Облепиховое масло в лечении ЖКТ

Внутреннее применение облепихового масла рекомендуется в комплексном лечении гастритов, язвенной болезни желудка и 12-типерстной кишки. При указанных заболеваниях масло назначается по 1 ч.л. перед едой (за 15 – 20 минут перед приемом пищи). Продолжительность курса лечения составляет примерно от 3 до 4-х недель (в зависимости от полученного лечебного эффекта).

Язва желудка. Народные целители рекомендуют проводить лечение по следующей методике:

1. Необходимо точно знать месторасположение язвы (на передней стенке желудка, на задней, справа-слева) — это можно выяснить при проведении эндоскопии.
2. Трижды в день (утром, в обед и перед ужином) выпить 1 ст.л. облепихового масла и лечь в кровать на ту сторону, где обнаружена локализация язвы (лежать 45 – 60 минут).
3. Курс лечения составляет 3 – 4 недели.
4. В период лечения соблюдать рекомендованную диету, полный отказ от спиртного и курения!

С целью профилактики масло облепихи назначают внутрь при проведении лучевой терапии при лечении злокачественных опухолей пищевода. Принимают масло по 1,5 – 2 ч.л. трижды в день на протяжении всего курса лучевой терапии, а также еще в течение от 2-х до 4-х недель после окончания процедур.

Облепиховое масло в лечении женской половой сферы

Эрозии шейки матки. При лечении эрозии облепиховое масло применяют в виде тампонов, пропитанных препаратом, которые вводят во влагалище на ночь. Предварительно необходимо спринцевание раствором календулы (на 1 стакан теплой кипяченой воды — 1 ч.л. спиртовой настойки ноготков). Кроме эрозии, по аналогичной методике проводят лечение в случае кольпитов и при эндоцервицитах. Лечение курсовое — в среднем по 10 – 15 процедур, проводимых ежедневно без перерыва. В силу различных причин лечение может оказаться малоэффективным — в этом случае необходимо сделать перерыв на полтора – два месяца, после чего пройти повторный курс. Известны случаи лечения облепиховым маслом (тампонаж в течение 50-ти дней) фибромиом, которые планировалось удалить оперативным путем.

Частные случаи применения облепихового масла

Гайморит. Для лечения рекомендуется вводить в гайморовы пазухи по 5 мл облепихового масла (стерильного). Такие процедуры проводятся дважды в день под наблюдением специалиста.

Стоматологические проблемы. При пародонтозе, гингивитах, стоматитах и прочих проблемах, которые относятся к сфере стоматологии, рекомендуется провести курс аппликаций с использованием облепихового масла. Пропитанные препаратом марлевые (ватные) жгуты прикладывать к пораженным деснам. Продолжительность процедуры составляет 10-15 минут.

Храп. Ночной храп нередко мешает окружающим, а происходит это явление по причине высыхания слизистой оболочки носовых пазух. Чтобы не беспокоить окружающих храпом, можно попробовать закапать перед сном по 1 капле облепихового масла в каждую ноздрю — часто помогает.

Геморрой. Для лечения геморроя и прочих проктологических проблем (анальные трещины, свищи и др.) рекомендуется делать микроклизмы с облепиховым маслом и каротолином (в соотношении 1:1). Кроме микроклизм необходимо несколько раз в сутки ставить компрессы с облепиховым маслом или смесью с каротолином. Продолжительность процедуры составляет от 1 до 2-х часов. Для повышения эффективности лечения рекомендуется сочетать наружное применение и пероральное употребление облепихового масла (по 1 ч.л. 1 – 2 раза в день).

Экзема. При лечении сочетают наружное применение облепихового масла и прием препарата внутрь (по 2 – 3 мл). Для смазывания пораженных участков кожи лучше использовать 5%-ную мазь, которую можно приобрести в аптечной сети.

Пролежни. У лежачих больных нередко появляются пролежни — раны на коже. Для лечения пролежней народные целители рекомендуют использовать раствор шампуня в водке (на пол-литра водки — 6 ст.л. шампуня) и облепиховое масло. Раствором шампуня обрабатывают пораженные участки кожи, а затем наносят слой облепихового масла (можно использовать 5%-ную мазь).

Ожоги. Тяжелые ожоги (от электрической дуги, кислотами или щелочами) трудно поддаются лечению обычным способом. Рецепт мази, приведенной ниже, позаимствован из практики народных целителей. Для приготовления необходимо взять пол-литра известковой воды, довести до кипения и влить 200 мл подсолнечного масла. Варить смесь в течение 3-х часов, после чего добавить по 50 г свиного смальца и бараньего жира, кусочек прополиса (размером с половину спичечного коробка) и столько же желтого воска. Когда ингредиенты расплавятся, массу снять с огня и добавить по 5 таблеток Анальгина и Стрептоцида (предварительно растолочь в порошок), флакон пенициллина и 2 ампулы Новокаина (Лидокаин или другой препарат, использующийся для анестезии), плюс 50 мл облепихового масла. Смесь энергично перемешать. Когда масса остынет, вверху соберется слой мази, который необходимо снять и переложить в стеклянную баночку. Жидкость также используется для лечения, только в ней необходимо растворить 3 яичных белка и 6 ампул активированного сока алоэ (продается в аптечной сети; препарат отпускается без рецепта). Известковая вода используется для промывания раневой поверхности и отмачивания присохших бинтов. Мазь применяют для компрессов. Известковую воду и мазь применяют до тех пор, пока не образуется грануляция по всей раневой поверхности, после чего лечение продолжают с использованием компрессов из облепихового масла или 5%-ной мази.

Простатит. Рецепт караимов (народность, проживающая на юге Украины). Для приготовления ректальных суппозиториев потребуется: облепиховое масло — 150 мл; по 30 г плодов аниса и молодых листьев березы. Семена аниса и березовые листья предварительно высушить и перемолоть в мельчайший порошок, чтобы не травмировать слизистую прямой кишки. Для получения необходимой вязкости нужно добавить пчелиный воск (облепиховое масло предварительно разогреть на водяной бане). Применяют лечебные суппозитории, как правило, 2 – 3 раза в сутки, вплоть до полного излечения.

Противопоказания и побочное действие

Противопоказаний для наружного применения облепихового масла не выявлено. Аллергические реакции при приеме масла внутрь встречаются крайне редко. При использовании его перорально (внутрь) следует учитывать, что для некоторых заболеваний такое применение может быть противопоказано. Облепиховое масло не рекомендуется использовать для лечения во время обострения воспалительных процессов в желчном пузыре, поджелудочной или печени.

Врачебная консультация — наиболее правильное решение, которое поможет избежать неожиданностей во время лечения при помощи облепихового масла.

Примечания

1. Сочетания не имеют противопоказаний в случае лечения указанных заболеваний.

2. Каротолин — масляный экстракт из мякоти плодов шиповника. Приготовление препарата в домашних условиях сходно с получением облепихового масла. Каротолин применяется для лечения экземы, трофических язв, ран и других травматических повреждений кожи.

Облепиховое масло – поможет только настоящее!

Первые упоминания о чудесных лечебных свойствах облепихи встречаются еще в старых медицинских манускриптах Тибета. Древние лекари не обладали современными знаниями, однако с успехом применяли различные части растения для приготовления действенных лекарственных снадобий.

И только многие века спустя облепиха приобрела всемирную славу, случилось это в начале 20 века, когда известный российский биохимик В. Ручкин впервые получил и описал тот самый «секретный компонент», в котором заключается вся лечебная сила растения — облепиховое масло.

Полная натуральность и высокая эффективность полученного лекарства быстро заслужили доверие врачей и народную любовь. И для того, чтобы удовлетворить потребности населения, в 1953 году в СССР было организовано первое промышленное производство облепихового масла. Был выбран один из самых экологически чистых уголков нашей планеты, место произрастания лучших сортов облепихи — Алтайский край, и первым к выпуску ценного облепихового масла приступил «Бийский витаминный завод» (с 1991 года — ЗАО «Алтайвитамины»).

От 25 недугов — облепиховое масло!

В наши дни облепиховое масло — одно из самых популярных природных лекарственных средств, которое не нуждается в усилении искусственными химическими компонентами. Его уверенно назначают своим пациентам ведущие врачи, и не менее активно используют поклонники народной медицины.

Фармакопейное (т. е. соответствующее по содержанию активных веществ лекарственным стандартам) облепиховое масло обладает очень разносторонним лечебным действием:

• Облепиховое масло — первое средство при язве желудка и двенадцатиперстной кишки. Благодаря выраженным регенеративным и ранозаживляющим свойствам, облепиховое масло способствует эффективному лечению, устраняя даже застарелые рубцы.

• Облепиховое масло широко применяется в гинекологической практике (лечение кольпитов, эндоцервицитов), а также для терапии эрозии шейки матки. Технически процедуры очень просты: используются тампоны, пропитанные маслом. Лечение проводится амбулаторно или в домашних условиях.

• Ускорить избавление от стоматита, пародонтоза и других воспалительных заболеваний полости рта можно с помощью нанесения аппликаций с маслом облепихи на пораженные участки.

• Являясь экологически чистым природным продуктом, облепиховое масло может применяться для лечения различных воспалительных заболеваний у беременных женщин, особенно в тех случаях, когда другие лекарственные препараты противопоказаны.

• Также масло рекомендовано при недостатке витаминов А и Е, дефицит которых может вызвать отсутствие или малое количество молока после родов. Оно используется для заживления трещин сосков, что является весьма распространенной проблемой у кормящих матерей.

Геморрой, трещины прямой кишки и сопутствующие проблемы составляют не менее обширную сферу применения облепихового масла. Препараты на его основе (свечи, микроклизмы) успешно используются для терапии данных заболеваний, обеспечивая быстрое заживление поврежденных тканей.

• При бронхите облепиховое масло принимают внутрь в виде ингаляций.

• Фитостерины, входящие в состав препарата связывают холестерин, поступающий с пищей, что снижает риск развития атеросклероза. Благодаря другим компонентам облепихового масла (витамин Е и фолиевая кислота) происходит укрепление стенок сосудов и повышение их эластичность.

• Масло облепихи также активно применяется при лучевой терапии онкологических заболеваний.

• Каротиноиды, содержащиеся в облепиховом масле, поддерживают зрение.

Болезни уха, горла и носа (аденоиды, ангина, гайморит, отит и т.д.) при использовании облепихового масла поддаются лечению гораздо легче обычного.

И это далеко не весь список распространенных заболеваний, с которыми способно справиться настоящее облепиховое масло.

Все ли масло лечит одинаково?

Говоря официальным языком, облепиховое масло – это препарат растительного происхождения, представляющий собой комплекс витаминов и биологически активных веществ.

Сегодня на прилавках аптек представлено множество марок данного продукта, однако далеко не все обладают реальным лечебным действием. Качество, а соответственно и лечебная эффективность масла облепихи, полностью зависит от трех важных моментов: места произрастания кустарника, содержания каротиноидов (главный действующий компонент препарата), а также способа извлечения масла из плодов.

Никогда низкокаротиноидный БАД из посредственного сырья не будет обладать эффективностью настоящего фармкокопейного облепихового масла, извлеченного из высокосортной спелой облепихи.

Так какое же масло может считаться настоящим?

Лекарственным (фармакопейным) может считаться только облепиховое масло, отвечающее следующим требованиям:

• Содержание каротиноидов не менее 180 мг/%;

• Использование специальных селекционных сортов облепихи, выращенных в экологически чистых районах;

• Контроль состава препарата официальными органами сертификации.

Редкое соответствие всем вышеуказанным требованиям имеет чистое фармакопейное облепиховое масло «Алтайвитамины» (ранее «Бийский витаминный завод»), выпуск которого продолжается и в наши дни. Неповторимое сочетание чистоты исходного сырья, выращенного в предгорьях Алтая, уникальной, выверенной десятками лет технологии обработки и высокого содержания действующих веществ, порождает чистый природный продукт с доказанными лекарственными характеристиками.

За 50-летнюю историю своего существования облепиховое масло «Алтайвитамины» завоевало мировую известность, и стало незаменимым лекарством для многих тысяч людей. Традиционное жидкое масло в темном флаконе, или современная форма капсульного масла «Алтайвитамины» — выбор всегда только за Вами! Главное — это полная уверенность в истинном качестве и высокой эффективности лекарства, подаренного нашему здоровью щедрой природой Алтая.

Спрашивайте облепиховое масло производства фармацевтической компании «Алтайвитамины» в аптеках вашего города.

Горячая линия (звонок по России бесплатный): 8-800-2008-988

www.altayvitamin.ru

Реклама

👆 Облепиховое масло при запорах

Применение облепихового масла при запорах – это не просто легкий, но и безопасный способ нормализации работы пищеварительной системы. Дополнительно вы снабдите организм полезными витаминами и микроэлементами. Прибегать к использованию средства следует при отсутствии стула дольше двух дней, но как именно принимать целебную ярко-оранжевую жидкость и в каких пропорциях мы расскажем вам далее.

Как действует облепиховое масло при запорах

Облепиховое масло от запора помогает взрослым и детям за счет множества полезных свойств. Изготавливают масло из спелых плодов, то есть оно относится к качественным натуральным средствам для борьбы с запорами.

Примечательно, что облепиховое масло для лечения запоров можно использовать даже при хронических формах кишечной непроходимости, а также оно подходит для профилактики. Средство отличается мощной слабительной способностью, поэтому при запоре отправляйтесь в аптеку за облепиховым маслом.

Как применять облепиховое масло от запоров

Вы можете использовать облепиховое масло от запора у детей и взрослых, но дозировки должны быть разными. Взрослым людям нужно действовать с учетом нескольких общих правил:

  • утром натощак всегда принимайте по ложечке чистого масла;
  • можно принять вторую дозу в середине дня, если только вам никуда не нужно идти, так как в любой момент средство может сработать, и вы побежите в туалет;
  • курс лечения должен длиться около месяца.

Покупайте только качественную ярко-оранжевую жидкость, желательно в аптеке

Читайте также

Как делать клизмы с облепиховым маслом от запоров

Использовать облепиховое масло при запорах у детей и взрослых можно при помощи микроклизм. Нужно разбавить 20 мл жидкости с 500 мл теплой воды. Вводите этот состав в анальное отверстие:

  • взрослым 100 мл;
  • детям 20-30 мл.

Клизму следует ставить перед сном, чтобы ночью целебные компоненты оказали воздействие на кишечник. Процедура совершенно безопасна, поэтому ее можно делать всем людям без исключения.

Применение облепихового масла при запорах у детей

Облепиховое масло для детей при запорах в чистом виде давать не рекомендуется, но можно использовать его в виде готовых свечей. Их можно ставить даже новорожденным малышам. Ректальные свечи с растительным компонентом не просто регулируют работу кишечника грудничка, но и смазывают анальный проход, исключая повреждение нежной поверхности кожи и образование раздражений.

Облепиховое масло ребенку при запорах в виде свечей даст лучший результат, если вы дополнительно будете массировать животик. Главным плюсом этого средства является абсолютная гипоаллергенность и мягкость воздействия.

Масло облепихи при запорах у беременных

Женщины в период беременности или после родов нередко страдают от запоров. Облепиховое масло от запора как принимать в этом случае поинтересуйтесь у лечащего врача. Обычные аптечные препараты, предназначенные для приема внутрь, могут негативно сказаться на развивающемся ребенка, поэтому лучше использовать натуральные растительные средства. Беременным нужно покупать в аптеке облепиховое масло в свечах и вводить их дважды в сутки после опорожнения или очистительной клизмы.

Улучшающее действие масла облепихи на мышей с атопическим дерматитом, индуцированным DNCB, посредством регуляции баланса Th2/Th3

BMC Complement Med Ther. 2020; 20: 263.

, # 1, 2 , # , # 1 , 3 , 4 , 5 , 5 , 5 , 5 и 5 5 5

Xinxin Wang

1 Liaoning Университет традиционной китайской медицины, Шеньян, Ляонин PR Китай

2 Базовая медицинская и судебно-медицинская медицина, Баотоу Медицинский колледж, Баотоу, Внутренняя монголия PR Китай

Sijia Li

Sijia Li

1 Liaoning Университет традиционной китайской медицины, Шеньян, Ляонин PR Китай

JIPING LIU

3 Департамент нейрохирургии, Северная больница Внутренняя Монголия, Баотоу, Внутренняя Монголия PR Китай

Dongning Kong

4 Ляонин Дуннин Фармцевтик Ко., Ltd., Fuxin, Liaoning PR China

Xiaowei Han

5 Колледж интегрированной традиционной китайской и западной медицины, Ляонинский университет традиционной китайской медицины, Chongshan Road NO.79, Shenyang, Liaoning 110847 PR China

Ping Lei

5 Колледж интегрированной традиционной китайской и западной медицины, Ляонинский университет традиционной китайской медицины, Chongshan Road NO.79, Shenyang, Liaoning 110847 PR China

Ming Xu

5 Колледж интегрированной традиционной китайской и западной медицины , Ляонинский университет традиционной китайской медицины, Чуншань-роуд №.79, Шэньян, Ляонин 110847 КНР

Хунцюань Гуань

5 Колледж интегрированной традиционной китайской и западной медицины, Ляонинский университет традиционной китайской медицины, Chongshan Road NO.79, Шэньян, Ляонин 110847 КНР

Diandong3 Ho

5 Колледж интегрированной традиционной китайской и западной медицины, Ляонинский университет традиционной китайской медицины, Chongshan Road NO.79, Шэньян, Ляонин 110847 КНР

1 Ляонинский университет традиционной китайской медицины, Шэньян, Ляонин КНР

2 Базовая медицинская и судебная медицина, Медицинский колледж Баотоу, Баотоу, Внутренняя Монголия, КНР

3 Отделение нейрохирургии, Северная больница Внутренней Монголии, Баотоу, Внутренняя Монголия, КНР

4 Liaoning Dongning Pharm., Ltd., Fuxin, Liaoning PR China

5 Колледж интегрированной традиционной китайской и западной медицины, Ляонинский университет традиционной китайской медицины, Chongshan Road NO.79, Shenyang, Liaoning 110847 P.R. China

Автор, ответственный за переписку.

# Внесли поровну.

Поступила в редакцию 29 декабря 2018 г.; Принято 22 июня 2020 г.

Открытый доступ Эта статья находится под лицензией Creative Commons Attribution 4.0 International License, которая разрешает использование, совместное использование, адаптацию, распространение и воспроизведение на любом носителе или в любом формате при условии, что вы укажете оригинал. автор(ы) и источник, предоставьте ссылку на лицензию Creative Commons и укажите, были ли внесены изменения.Изображения или другие сторонние материалы в этой статье включены в лицензию Creative Commons на статью, если иное не указано в кредитной строке материала. Если материал не включен в лицензию Creative Commons статьи, а ваше предполагаемое использование не разрешено законом или выходит за рамки разрешенного использования, вам необходимо получить разрешение непосредственно от правообладателя. Чтобы просмотреть копию этой лицензии, посетите http://creativecommons.org/licenses/by/4.0/. Отказ от права Creative Commons на общественное достояние (http://creativecommons.org/publicdomain/zero/1.0/) применяется к данным, доступным в этой статье, если иное не указано в кредитной строке данных. Эта статья цитировалась в других статьях в PMC.

Abstract

История вопроса

Атопический дерматит (АД) является хроническим кожным заболеванием, которое обременяет общественное здравоохранение во всем мире. Масло облепихи (SBT) ( Hippophae rhamnoides L., Elaegnaceae) как традиционное растительное лекарственное средство уже много лет используется для лечения заболеваний. В этом исследовании оценивалось влияние масла SBT на модель мышей AD, вызванное повторным введением 2,4-динитрохлорбензола (DNCB) мышам BALB/c.

Методы

Мышей разделили на четыре группы, включая нормальную контрольную группу, группу модели AD, группу модели AD, получавшую масло SBT (5 мл/кг), и группу модели AD, получавшую масло SBT (10 мл/кг). Один и тот же объем масла SBT в разных концентрациях применяли ежедневно в двух последних группах через зонд в течение 15 дней после индукции модели AD. Функцию кожного барьера и продукцию IL-4, IFN-γ, TNF-α и TSLP исследовали после умерщвления животных. Миграцию и созревание клеток Лангерганса (LC) в лимфатических узлах дополнительно оценивали с помощью проточной цитометрии.

Результаты

Масло SBT облегчало симптомы дерматита, уменьшало толщину уха, предотвращало инфильтрацию тучных клеток, уменьшало массу лимфатических узлов и снижало активность клеток Th3. Масло SBT также снижало экспрессию IL-4, IFN-γ, TNF-α и TSLP в ткани уха, уровень IgE в сыворотке и относительную экспрессию мРНК IL-4, IFN-γ, TNF-α в лимфатических узлах. Более того, масло SBT ингибировало миграцию клеток LCs из местных очагов поражения в лимфатические узлы, и они созревали в лимфатических узлах.

Выводы

Эти результаты свидетельствуют о том, что масло SBT оказывает благотворное системное или местное действие на мышей с AD, индуцированной DNCB, посредством поддержания баланса Th2/Th3 и может быть потенциальным дополнительным кандидатом для лечения AD.

Ключевые слова: Атопический дерматит, облепиховое масло, 2,4-динитрохлорбензол, цитокин 1, 2]. Распространенность БА как общего заболевания общественного здравоохранения в последние годы увеличилась [3, 4]. AD затрагивает почти 20% детей и 3% взрослых во всем мире, и количество случаев становится все больше и больше [5].Хотя патогенез БА не совсем ясен, считается, что генетический риск, факторы окружающей среды, дисфункция кожного барьера и иммунная дисрегуляция играют важную роль в патогенезе БА [5–8]. Что касается иммунной дисрегуляции, перекос Th3, по-видимому, является ключевым моментом патогенеза БА [9, 10]. Иммунологическое нарушение баланса Th2/Th3 из-за сильного иммунного ответа 2-го типа, характеризующегося гиперинфильтрацией тучных клеток, повышенной продукцией цитокинов Th3 и уровнем IgE в сыворотке крови, играет решающую роль в возникновении и течении БА.Эти цитокины Th3 впоследствии индуцируют высвобождение других провоспалительных цитокинов, таких как IFN-γ, посредством активации клеток Th2 [11].

Из-за тяжелого бремени болезни Альцгеймера, возложенного на общество и пациентов [12, 13], подходы к лечению крайне необходимы. В клинической практике для лечения БА обычно применяли местные смягчающие средства и системные кортикостероиды [14, 15]. Однако эксперты Международного совета по экземе пришли к выводу, что, хотя использование кортикостероидов для лечения АтД широко распространено, оно также не рекомендуется из-за побочных эффектов и риска рецидива.Принимая во внимание потенциальный опасный побочный эффект местного применения стероидов и иммунодепрессантов [14, 16], существует большой энтузиазм в поиске альтернативных и дополнительных препаратов для лечения БА. В последнее время большое внимание привлек поиск новых потенциальных кандидатов из природных материалов для лечения БА [11, 17–20].

SBT — это дикорастущий листопадный кустарник или карликовое дерево, принадлежащее к семейству Elaegnaceae, которое широко используется в тибетской, монгольской и китайской традиционной медицине для лечения заболеваний [21–23].По мнению многих исследователей, СБТ обладает различными лечебными эффектами, такими как противоопухолевый, антистрессовый, противовоспалительный, противоязвенный, антиоксидантный, заживляющий, регулирующий сердечно-сосудистую и иммунную системы [24–28]. Масло SBT, содержащее богатые жирные кислоты, токоферолы, ω3 и ω6 и т. д., является основной биоактивной частью SBT, и было доказано, что оно оказывает благотворное влияние на состояния воспаления кожи и обладает способностью улучшать состав жирных кислот в коже [29]. , 30]. Таким образом, это исследование было проведено для изучения благотворного влияния масла SBT на модель AD у мышей, индуцированной DNCB, и его возможного механизма.

Методы

Масло SBT

Масло SBT было предоставлено Liaoning Dongning Pharmaceutical Co. LTD. Масло экстрагировали из высушенного прессового остатка (включая мякоть ягод, семена и кожуру) переработки сока СБТ асептическим процессом сверхкритического диоксида углерода. Анализ образцов проводили с использованием капиллярной колонки HP-5MS (30 м ×0,25 мм, 0,25 мкм, Agilent Technologies Inc., Санта-Клара, Калифорния, США) в ГХ/МС (5975C, Agilent Technologies Inc). Образец вводили в колонку и анализировали в режиме разделения (коэффициент разделения = 10:1).Газ-носитель гелий был запрограммирован на поддержание постоянной скорости потока 1  мл/мин. Духовка была первоначально нагрета до 80°С в течение 3 мин, затем, наконец, доведена до 300°С со скоростью 4°С/мин. Жирные кислоты идентифицировали с помощью эталонной стандартной смеси FAME (Supelco, Bellefonte, PA, USA), проанализированной в тех же рабочих условиях, что и те, которые использовались для FAME образцов. Компоненты масла СБТ представлены в таблице.

Таблица 1

Основные жирные кислоты и содержание ситостерола и β-каротина в масле SBT

) кислота (C18:2)
Жирные кислоты (%) Ситостерол (мг/г) β-каротин
Миристиновая кислота (C14:0) Пальмитиновая кислота (C16:0) Пальмитолеиновая кислота
(C16:1)
Стеариновая кислота (C18:0) Олеиновая кислота (C
Линоленовая кислота (C18:3)
0.83 26,87 27.52 1,2 33.1 33.1 43 9 1.5 15,0 6.9

Животные и животные Лечение

Женщина Здоровые Удельные патогенные Mached Balb / C, в возрасте 6- 8 недель, взвешенные 20 ± 2 г, были предоставлены Liaoning Changsheng Biotechnology Co., Ltd. (Бэньси, Китай). Всех мышей поместили в группы по 6 мышей в клетке, ожидающих группировки в специальной среде, свободной от патогенов, с 12-часовым циклом свет-темнота и давали им свободно пить и есть.Мышей акклиматизировали в течение 1 недели перед индукцией модели AD. Мыши были случайным образом разделены на 4 группы: нормальная контрольная группа, модельная группа БА, модельная группа БА, получавшая масло СБТ (5 мл/кг), и модельная группа БА, получавшая масло СБТ (10 мл/кг), в каждой группе по 6 мышей. . Спинную кожу каждой мыши выбривали после сенсибилизации DNCB (200 мкл, 1%) в общей сложности три раза с 1 по 7 день, а кожу левого уха подвергали воздействию DNCB (20 мкл, 0,5%) в общей сложности семь раз с с 14 по 29 день. Группе модели AD, получавшей масло SBT (5 мл/кг), давали 0.1 мл масла SBT плюс 0,1 мл оливкового масла на мышей, группе моделей AD, получавших масло SBT (10 мл/кг), давали 0,2 мл масла SBT на мышей. Масло наносили внутрижелудочно один раз в день с 15 по 29 день, оливковое масло (0,2 мл) давали в одно и то же время нормальной контрольной группе и группе модели AD. При этом каждые 3 дня измеряли толщину левого уха. Всех животных забивали на 30-й день и собирали образцы, включая кровь, ткани левого уха и подчелюстные лимфатические узлы, мышей анестезировали 1.2% раствор авертина (0,5 г порошка 2,2,2-трибромэтанола, растворенного в 1 мл 2-метил-2-бутанола и 39 мл PBS при 55°C), который фильтровали с использованием фильтра Nalgene 0,22 мкм (Thermo Fisher Scientific, Inc. ., Уолтем, Массачусетс, США) и умерщвляли обескровливанием [31]. Натурные процедуры индукции и лечения моделей БА показаны на рис. Все проведенные экспериментальные процедуры были одобрены Этическим комитетом по уходу за экспериментальными животными при Ляонинском университете традиционной китайской медицины (Шэньян, КНР).

Общая схема индукции модели AD и лечения маслом SBT

Оценка тяжести AD

Тяжесть дерматита оценивали по толщине уха и баллам дерматита методом слепых. Толщину ушей измеряли каждые 3 дня, начиная с 15-го дня, с помощью цифрового толщиномера (Mitutoyo Co., Канагава, Япония). Оценка дерматита рассчитывалась по 4 основным характеристикам: сухость/корки, кровоизлияния/эритема, эрозии/экскориации и отек [32]. Каждый из них был отмечен по шкале от 0 (отсутствие), 1 (легкая), 2 (умеренная) до 3 (тяжелая).Общая оценка дерматита состояла из суммы индивидуальных баллов в диапазоне от 0 до 12 [33].

Гистопатологический анализ

Образцы левого уха мышей собирали на 30-й день, затем фиксировали в 10% формалине и заливали в парафин. Срезы (толщиной 5 мкм) окрашивали либо гематоксилином и эозином (H&E) для визуализации толщины дермы и эпидермиса, либо толуидиновым синим (TB) для визуализации количества тучных клеток. Тучные клетки подсчитывали в 3 секциях полей зрения при увеличении 200 × .

Иммуногистохимия

Вкратце, после депарафинизации и регидратации предметные стекла ткани уха обрабатывали 0,3% перекисью водорода-метанолом для ингибирования эндогенной пероксидазы и высоким давлением для извлечения антигена. Затем препараты инкубировали с овечьей сывороткой в ​​течение 30 мин при 37°С, с первичными антителами (Abcam) в течение ночи при 4°С, с вторичными антителами, предоставленными Zhongshanjinqiao (Пекин, Китай), в течение 1 ч при 37°С. Наконец, предметные стекла были окрашены диаминобензидином (DAB), предоставленным Zhongshanjinqiao (Пекин, Китай) для окрашивания.Результат был проанализирован ImageJ.

Полимеразная цепная реакция в реальном времени (RT-PCR)

Подчелюстные лимфатические узлы мышей собирали и взвешивали, в то время как умерщвление и тотальную РНК экстрагировали из тканей лимфатических узлов с использованием реагента TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) в соответствии с инструкциями производителя. протоколы и обратно расшифрованы с помощью набора реагентов Prime ScriptTMRT (TaKaRa Biotechnology Co., Ltd., Далянь, Китай). Анализ полимеразной цепной реакции в режиме реального времени выполняли в соответствии с протоколами SYBR®Premix Ex TaqTM II (TaKaRa Biotech Co., Ltd., Далянь, Китай), а праймеры, использованные в этом исследовании, были разработаны, как показано в таблице. Относительные количества всех мишеней в тестируемых образцах были нормализованы к их соответствующим уровням GAPDH. Метод 2 -ΔΔCt использовали для количественного определения относительной экспрессии.

Таблица 2

Таблица 2

IL-4 9019 3

проточный цитометрия

для проточной цитометрии были предоставлены BD (США), и схема выполнялась после индукции.Около 1 × 10 6 –5 × 10 6 клеток подчелюстного лимфатического узла собирали в ЭП пробирку, центрифугировали при 1500 об/мин и 4 °C в течение 5 мин. 100 мкл PBS смешивали с клетками после удаления супернатанта, затем добавляли еще 100 мкл PBS, содержащего флуоресцентные антитела, для окрашивания при 4°С в течение 20 мин и хранили от воздействия солнечных лучей. Добавляли 500 мкл PBS и повторно перемешивали для промывки, затем центрифугировали при 5000 об/мин и 4°С в течение 5 мин. Супернатант осторожно удаляли, добавляли еще 500 мкл PBS и перемешивали.Наконец, смесь переносили в проточную трубку для проточной цитометрии.

Статистический анализ

Данные представлены как среднее ± SD. Достоверность различий разных групп оценивали с помощью однофакторного дисперсионного анализа (ANOVA) с последующим t-критерием Даннета. Р<0,05 считалось статистически значимым.

Результаты

Масло SBT оказывает благотворное влияние на кожу против развития DNCB-индуцированных моделей AD у мышей BALB/c мл/кг, 10 мл/кг) вводили через желудок один раз в день после индукции модели AD с помощью DNCB, показанной на рис.. Местное применение DNCB, включая сенсибилизацию и провокацию, вызывало поражения кожи, подобные AD, проявляющиеся в виде эритемы, зуда и кровоизлияний, сопровождаемых аномальными расчесами и сухостью. Тяжесть дерматита оценивали по толщине уха и шкале дерматита. Толщину уха измеряли каждые 3 дня, начиная с 15-го дня, а показатели дерматита оценивали в соответствии с 4 основными характеристиками, как описано ранее. После введения масла SBT в течение 15 дней толщина уха и показатели дерматита значительно уменьшились в зависимости от дозы по сравнению с модельной группой AD (рис.).

Воздействие масла SBT на модель кожи AD, индуцированной DNCB. a Примеры характерных для БА поражений кожи. b Толщина ушей мышей. c Показатели дерматита суммировали по сумме баллов в соответствии с различными симптомами БА. ## P  < 0,01, # P  < 0,05 vs. контрольная группа; ** p  < 0,01, * p  < 0,05 по сравнению с группой модели AD

Масло SBT способствовало восстановлению кожного барьера и уменьшению инфильтрации тучных клеток у мышей модели AD, индуцированной DNCB

Для оценки эффекта Гистологически на предметных стеклах тканей проводили окрашивание H&E и TB маслом SBT на поражениях кожи, подобных AD.Повторяющееся применение DNCB вызывало утолщение дермы, гиперплазию эпидермиса и усиление инфильтрации тучных клеток в модельной группе AD. В то время как, согласно окрашиванию H&E, толщина дермы и эпидермиса уменьшилась, а эпидермальная гиперплазия была подавлена ​​после введения масла SBT в течение 15 дней, что зависело от дозировки (рис. а, б). По данным окрашивания ТБ, число инфильтратов тучных клеток также уменьшилось у мышей, получавших масло СБТ (рис. б, в).

Влияние масла SBT на гистологическую ткань кожи уха. и окрашивание H&E. × 200 ( : эпидермис; : дерма). b Толщина дермы и эпидермиса в ткани, окрашенной H&E, количество тучных клеток в ткани, окрашенной TB. c окраска ТБ. × 200( : тучные клетки)

Масло SBT уменьшало вес лимфатических узлов у мышей с моделью AD, индуцированной DNCB

После умерщвления мышей собирали и взвешивали подчелюстные лимфатические узлы, чтобы оценить, играет ли масло SBT роль в процессе индукции AD . Результаты показали увеличение веса подчелюстных лимфатических узлов в группе модели AD, которое было снижено при введении масла SBT (рис.).

Вес подчелюстного лимфатического узла. Подчелюстной лимфатический узел. Вес лимфатического узла В. (а). Нормальная контрольная группа, (б). Группа моделей AD, (c). Обработано маслом SBT (5 мл/кг), (d). Обработано маслом СБТ (10 мл/кг). ## P  < 0,01, # P  < 0,05 по сравнению с контрольной группой; ** p  < 0,01, * p  < 0,05 по сравнению с модельной группой AD DNCB

Чтобы оценить влияние масла SBT на регуляцию цитокинов Th2/Th3, экспрессию IL-4, IFN-γ, TNF-α и TSLP у мышей с моделью AD исследовали с помощью иммуногистохимического окрашивания предметных стекол ткани уха.Результаты показали положительную регуляцию экспрессии IL-4, IFN-γ, TNF-α и TSLP в модельной группе AD, которая ингибировалась в зависимости от дозы при применении масла SBT (рис. ).

Влияние масла SBT на экспрессию IL-4, IFN-γ, TNF-α и TSLP в тканях уха. a Иммуногистохимическое окрашивание IL-4, IFN-γ, TNF-α и TSLP в ткани уха. b Анализ AOD IL-4, IFN-γ, TNF-α и TSLP. ## P  < 0,01 по сравнению с контрольной группой; ** р  < 0.01 по сравнению с модельной группой AD

SBT снижает уровень IgE в сыворотке и мРНК относительной экспрессии IL-4, IFN-γ и TNF-α в лимфатических узлах

Затем мы измерили уровень IgE в сыворотке с помощью ELISA и мРНК относительная экспрессия IL-4, IFN-γ и TNF-α в лимфатических узлах с помощью RT-PCR. Мы обнаружили, что уровень IgE в сыворотке был повышен у мышей с моделью AD, индуцированной DNCB. Увеличение было значительно подавлено в группах, получавших масло SBT в зависимости от дозы. Как и выше, относительная экспрессия мРНК IL-4, IFN-γ и TNF-α в лимфатических узлах была увеличена в группе модели AD и снижена в группах, получавших масло SBT (рис.).

Влияние масла SBT на уровень IgE в сыворотке и относительную экспрессию мРНК IL-4, IFN-γ и TNF-α в лимфатических узлах. и уровень IgE в сыворотке. b Относительная экспрессия мРНК IL-4, IFN-γ и TNF-α в лимфатическом узле. ## P  < 0,01, # P  < 0,05 по сравнению с контрольной группой; ** p  < 0,01, * p  < 0,05 по сравнению с модельной группой AD

Масло SBT уменьшило количество LC в дренирующем лимфатическом узле и экспрессию CD86, OX40L и MHCII на LCs

Для оценки влияние масла SBT на созревание и миграцию клеток LC в подчелюстных лимфатических узлах, мы определили количество клеток, экспрессирующих CD207 / CD326, CD86, CD80, OX40L и MHC II, с помощью проточной цитометрии.Результаты, показанные на рис. , показали, что экспрессия клеток CD207/CD326, CD86, OX40L и MHCIIon LC в подчелюстных лимфатических узлах была увеличена в группах моделей AD, индуцированных DNCB, и снижена в группах, обработанных маслом SBT.

Влияние масла SBT на созревание и миграцию LC-клеток. a Диаграмма рассеяния, показывающая долю клеток в лимфатическом узле, экспрессирующих CD207 + CD326 + , MHC II, CD86, CD80 и OX40L. b Гистограмма вышеупомянутых результатов. ## P  < 0,01, # P  < 0,05 vs. контрольная группа; ** p  < 0,01, * p  < 0,05 по сравнению с модельной группой AD

Обсуждение

AD представляет собой кожное воспалительное заболевание, индуцированное гаптеном и опосредованное Т-клетками. Клинически основными характеристиками АД являются эритема, отек, папула, волдырь, пузырь, буллезная реакция и даже некроз. Патологическими изменениями БА были инфильтрация воспалительными клетками и отек тканей.В этом исследовании мы использовали модель AD, индуцированную DNCB, с использованием мышей BALB/c, которые были предложены в качестве подходящего представителя AD человека из-за сходных симптомов, включая эрозию кожи, кровоизлияние, эпидермальную гиперплазию, инфильтрацию тучных клеток и повышенный уровень IgE в сыворотке и т. д. Масло СБТ, как и традиционные растительные экстракты, обладает разносторонним фармакологическим действием, таким как противовоспалительное, снижающее давление, защищающее эндотелиальные клетки сосудов и иммуномодулирующее действие [25, 26].Основные составляющие масла SBT включают жирные кислоты (такие как миристиновая кислота, пальмитиновая кислота, пальмитолеиновая кислота, олеиновая кислота и т. д.), ситостерол и β-каротин. Жирные кислоты являются важнейшими компонентами клеточных мембран и играют важную роль в биологической функции клеток [34]. Некоторые из жирных кислот необходимы для активации врожденного иммунитета и защиты от патогенов [35]. Ситостерол является основным компонентом многих растений и овощей и обладает способностью модулировать функции макрофагов и противовоспалительным средством [36, 37].Также было показано, что β-каротин подавляет клеточный и тканевой ответ на воспаление [38, 39]. Принимая во внимание иммунорегулирующее и противовоспалительное действие масла СБТ, мы оценили анти-АД эффекты масла СБТ in vivo.

Местное применение DNCB в соответствии со схемой, включая сенсибилизацию и провокацию, вызывающую АД-подобные поражения кожи, проявляющиеся в виде эритемы, зуда и кровоизлияния, сопровождаемые аномальными расчесами и сухостью. Толщина уха и показатели дерматита были значительно увеличены в группе модели AD по сравнению с контрольной группой.После введения масла СБТ в течение 15 дней толщина уха и показатели дерматита в группах, получавших масло СБТ, были значительно уменьшены дозозависимым образом по сравнению с модельной группой БА, что указывает на то, что введение масла СБТ подавляло развитие поражений кожи, подобных БА. .

АтД признан Th3-опосредованным аллергическим заболеванием с гиперэкспрессией цитокинов Th3 и повышенным уровнем IgE в сыворотке [9]. Будучи антителом, синтезируемым плазматическими клетками, IgE играет существенную роль в некоторых случаях гиперчувствительности, таких как AD, аллергическая астма и аллергический ринит.IgE обладает способностью повышать продукцию цитокинов Th3. Цитокины Th3 IL-4 индуцировали переключение иммуноглобулинов в плазматических клетках, что приводило к повышению уровня сывороточного IgE. Тучные клетки, как один из зернистых лейкоцитов, могут высвобождать многие цитокины, чтобы опосредовать воспалительную реакцию и иммунную регуляцию. Эти цитокины также участвуют в патологических проявлениях многих аллергических заболеваний, включая БА [40]. Инфильтрация тучных клеток, активированная IgE, является одним из ключевых признаков АД-подобных поражений кожи [41, 42].Цитокины, высвобождаемые из активированных тучных клеток, привлекают эозинофилы в кожу, вызывая повреждение кожных тканей. Гистологически, в соответствии с окрашиванием ТБ, количество инфильтратов тучных клеток в ткани кожи уха у мышей с моделью AD увеличивалось при применении DNCB и значительно ингибировалось маслом SBT. Результаты показали, что масло SBT оказывает благотворное влияние на подавление накопления тучных клеток в тканях кожи у мышей с AD, индуцированных DNCB. Наши результаты окрашивания ТБ показали, что тучные клетки в ткани кожи были скудными в контрольной группе, в то время как в модельной группе AD их было много, что в высокой степени соответствует патологическим изменениям при AD.Количество тучных клеток значительно уменьшилось после введения масла SBT в группе, получавшей масло SBT, по сравнению с группой модели AD. Эти результаты свидетельствуют о том, что масло SBT оказывает ингибирующее действие на инфильтрацию тучных клеток.

Согласно опубликованным исследованиям, гиперэкспрессия цитокинов Th3 идет рука об руку с TSLP. TSLP, который может сильно способствовать дифференцировке клеток Th0 в фенотип Th3 посредством активации дендритных клеток (DC) [43], был определен как решающий фактор в индукции перекоса Th3 при AD.Было показано, что экспрессия TSLP заметно повышена в кератиноцитах очагов БА как у пациентов с БА, так и на моделях мышей [44]. ИЛ-4, в свою очередь, может индуцировать синтез TSLP кератиноцитами. Важно отметить, что миграция DCs в дренирующие лимфатические узлы была вызвана TSLP. Что еще более интересно, цитокины Th2 IFN-γ, которые могут активировать кератиноциты, также были повышены при БА. IFN-γ и TNF-α могут синергически стимулировать высвобождение цитокинов и хемокинов при хронической стадии БА. В нашем исследовании обработка маслом SBT снижала повышенный уровень IgE в сыворотке, вызванный применением DNCB.Более того, обработка маслом SBT также снижала вызванное DNCB повышение экспрессии IL-4, IFN-γ, TNF-α и TSLP в ткани уха и относительную экспрессию мРНК IL-4, IFN-γ и TNF-α в лимфатических узлах. Эти результаты свидетельствуют о том, что масло СБТ облегчало симптомы БА частично за счет подавления активности клеток Th2/Th3. В соответствии с подавляющим действием масла SBT на экспрессию TSLP в ткани уха, мы предположили, что масло SBT может обладать способностью подавлять как активацию, так и миграцию клеток DC.Чтобы прояснить наше предположение, для дальнейшего изучения ЖК использовали проточную цитометрию.

Дренирование лимфатических узлов играет важную роль в патогенезе БА. Вес и объем лимфатического узла будут увеличиваться вместе с усиленной функцией, когда он активен. Мы исследовали местные лимфатические узлы различными способами. Прежде всего, вес подчелюстных лимфатических узлов у мышей с моделью AD, индуцированной DNCB, значительно увеличился, что заметно уменьшилось после внутрижелудочного применения масла SBT в течение 15 дней в зависимости от дозы.Далее мы оценили экспрессию CD207/CD326, MHC класса II, CD80, CD86 на LC и OX40L на CD4 + Т-клетках в лимфатических узлах с помощью проточной цитометрии, поскольку комплексная иммунная реакция при AD в основном происходила в лимфатических узлах. Лангерин (CD207), трансмембранный белок типа II, представляет собой лекцию LC С-типа [45]. LC являются виртуальными посредниками иммунного надзора и толерантности, которые обитают в эпидермисе в виде субпопуляции DC [46]. Антигены, как внешние, так и внутренние, были захвачены LC и представлены клеткам Th0 в дренирующем кожу лимфатическом узле.CD207 является единственным поверхностным антигеном, ограниченным только LC [47]. Молекула адгезии эпителиальных клеток (EpCAM, CD326), белок клеточной поверхности, в высокой степени экспрессируется на LC и, по-видимому, стимулирует миграцию LC [48]. Поскольку CD207 + CD326 + в качестве основного символа LCs мигрировали в лимфатический узел, изменения доли показали, что масло SBT подавляло миграцию клеток LC из кожного поражения в дренирующий лимфатический узел. После деградации белков, происходящих из внеклеточной среды, они были поглощены эндоцитозом или фагоцитозом и захвачены молекулами MHC класса II, затем в результате получился MHC II, нагруженный пептидами, и они мигрировали на поверхность антигенпрезентирующей клетки в ожидании распознавания CD4 + Т-клетками, наконец, активируют адаптивный иммунный ответ [49].Повышенная доля клеток MHC класса II указывала на тенденцию к повышению зрелых LC в лимфатических узлах у мышей с моделью AD, индуцированной DNCB, по сравнению с нормальными контрольными мышами. В то время как эта восходящая тенденция подавлялась применением масла СБТ у мышей, получавших масло СБТ. Постоянные эпидермальные LC в норме являются незрелыми и почти не экспрессируют костимулирующие молекулы, такие как CD80 и CD86. В то время как при созревании LC экспрессия этих костимулирующих молекул усиливалась. В этом исследовании масло SBT снижало экспрессию CD86 на LC в лимфатических узлах, которая была усилена DNCB у мышей с моделью AD.Это предполагает влияние масла SBT на ингибирование созревания LC. OX40 (CD134) представляет собой трансмембранный белок члена суперсемейства рецепторов фактора некроза опухоли, который в основном экспрессируется на активированных CD4 + Т-клетках и активируется при воспалительных поражениях на антиген-активированных Т-клетках [50, 51]. TSLP может стимулировать экспрессию лиганда OX40 (OX40L) на LC. LC, экспрессирующие OX40L, мигрируют из очага поражения кожи в локальные лимфатические узлы и индуцируют трансформацию клеток Th0 в клетки Th3. С одной стороны, повышенная доля клеток OX40L + в лимфатических узлах мышей с AD, индуцированной DNCB, подавлялась введением масла SBT, что подтверждало влияние масла SBT на активацию CD4 + Т-клеток. масло способствовало нормальной функции LC за счет обновления кератиноцитов и подавления высвобождения TSLP.В результате аномальное перекос Th3 воспаление подавлялось введением масла SBT.

В целом, наши результаты свидетельствуют о том, что масло SBT ингибировало как миграцию LC в лимфатический узел, так и его созревание в лимфатическом узле, тем самым подавляя трансформацию клеток Th0 в клетки Th3 и, наконец, ограничивая возникновение воспалительной реакции типа Th3.

Заключение

Таким образом, результаты нашего исследования показали, что применение масла SBT подавляло DNCB-индуцированные симптомы БА, снижая уровень IgE в сыворотке и выработку цитокинов и хемокинов, а также регулируя баланс Th2/Th3.Кроме того, наши результаты также показали, что обработка маслом SBT ингибировала миграцию LC в дренирующие лимфатические узлы и их созревание. В совокупности масло СБТ обладает превосходным терапевтическим эффектом при воспалительных заболеваниях кожи и может быть потенциальным дополнительным кандидатом для лечения АтД. В дальнейших исследованиях будет полезно изучить механизм действия масла СБТ и его активного компонента при лечении БА.

Gene Sequence
IL-4 IL-4 IL-4 IL-4 IL-4 IL-4 IL-4 IFN-γ Вперед: 5′- TGAGCTCATTGAATGCTGG-3 ‘
Reverse: 5′- GGCCATCACAACAACAATAAA-3′
TNF-α Вперед: 5′-GGAAAGGACGGGGACTGHTGTA-3 ‘
Реверс: 5′- TGCCACTGGTCTCTCTAATCACA -3 ‘
GAPDH Reside: 5′-TGGTGAAGGTCGTGTGTGAAC-3′
Reverse: 5′-ECTGTGCCGTTGATTTTGCC-3 ‘
Сокращения
А.Д. атопический дерматит
Dab диаминобензидина
РС дендритных клеток
DNCB 2,4-динитрохлорбензол
ОН гематоксилин и эозином
ИФН-γ Интерферон-γ
IgE Иммуноглобулин Е
ИЛ-4 Интерлейкин-4
ЛЦ клетки Лангерганса
MHCII Основная гистосовместный комплекс II
RT-PCR RT-PCR RT-PCR Реакция цепной реакции в реальном времени
SBT Морская обшивка
TB ToLuidine Blue
TH2 T-Helper 1
Th3 T-помощник 2
TNF-α Фактор некроза опухоли-α
TSLP Стромальный лимфопоэтин тимуса

Вклад авторов рукописи

XX W выполнили эксперимент.SJL и JPL помогли провести эксперимент. DNK и XWH провели статистический анализ, PL и MX выполнили интерпретацию. HQG и DDH пересмотрели исследование и рукопись. DDH разработал эксперимент и представил рукопись. Все авторы прочитали и одобрили окончательный вариант рукописи.

Финансирование

Этот проект был поддержан Национальным фондом естественных наук Китая (грант № 81774023), который был предоставлен Diandong Hou. Результаты, указанные в этой рукописи, были главными достижениями проекта.

Наличие данных и материалов

Все данные и материалы содержатся и описаны в рукописи.

Этическое одобрение и согласие на участие

Все экспериментальные процедуры проводились в соответствии с рекомендациями, предоставленными Комитетом по этике экспериментального ухода за животными при Ляонинском университете традиционной китайской медицины (Шэньян, КНР).

Согласие на публикацию

Неприменимо.

Конкурирующие интересы

Авторы заявляют об отсутствии потенциального конфликта интересов.

Сноски

Примечание издателя

Springer Nature остается нейтральной в отношении юрисдикционных претензий в опубликованных картах и ​​институциональной принадлежности.

Xinxin Wang и Sijia Li внесли равный вклад в эту работу.

Информация об авторе

Синьсин Ван, электронная почта: [email protected]

Сиджия Ли, электронная почта: [email protected]

Цзипин Лю, электронная почта: [email protected]

Dongning Kong, электронная почта: [email protected]

Сяовэй Хан, электронная почта: [email protected]

Пинг Лей, электронная почта: [email protected]

Мин Сюй, электронная почта: [email protected]

Хунцюань Гуань, электронная почта: [email protected]

Диандонг Хоу, электронная почта: [email protected]

Ссылки

1. Klonowska J, et al. Новые цитокины в патогенезе атопического дерматита – новые терапевтические мишени. Int J Mol Sci. 2018;19(10):3086. [Бесплатная статья PMC] [PubMed] [Google Scholar]2. Чупани Р. и др.Лечение атопического дерматита с точки зрения традиционной персидской медицины: презентация нового терапевтического подхода. Дополнительная альтернативная медицина на основе J Evid. 2017;22(1):5–11. [Бесплатная статья PMC] [PubMed] [Google Scholar]3. Бруннер П.М., Гуттман-Ясский Э., Леунг Д.Ю. Иммунология атопического дерматита и его обратимость с помощью широкого спектра и таргетной терапии. J Аллергия Клин Иммунол. 2017;139(4S):S65–S76. [Бесплатная статья PMC] [PubMed] [Google Scholar]6. Ким Дж. и др. Молекулярный механизм индукции атопического дерматита после сенсибилизации и заражения 2,4-динитрохлорбензолом в ткани кожи мыши.Токсикол рез. 2018;34(1):7–12. [Бесплатная статья PMC] [PubMed] [Google Scholar]7. Хоу Д.Д. и соавт. Масло облепихи (Hippophae rhamnoides L.) улучшает состояние кожи при атопическом дерматите за счет ингибирования активации NF-kappaB и STAT1. Skin Pharmacol Physiol. 2017;30(5):268–276. [PubMed] [Google Scholar] 11. Парк Дж. Г. и др. Табетри (этаноловый экстракт Tabebuia avellanedae) облегчает симптомы атопического дерматита у мышей. Медиат воспаления. 2018; 2018: 9079527. [Бесплатная статья PMC] [PubMed] [Google Scholar]12. Шреста С. и др.Бремя атопического дерматита в Соединенных Штатах: анализ данных о заявлениях на получение медицинской помощи в коммерческих базах данных, базах данных Medicare и Medi-Cal. Adv Ther. 2017;34(8):1989–2006. [Бесплатная статья PMC] [PubMed] [Google Scholar]13. Арима К. и др. Бремя атопического дерматита у взрослых японцев: анализ данных национального исследования здоровья и благополучия 2013 года. J Дерматол. 2018;45(4):390–396. [Бесплатная статья PMC] [PubMed] [Google Scholar]15. Глатц М. и соавт. Использование смягчающих средств изменяет кожный барьер и микробы у младенцев с риском развития атопического дерматита.ПЛОС Один. 2018;13(2):e0192443. [Бесплатная статья PMC] [PubMed] [Google Scholar]16. Друкер А.М. и соавт. Использование системных кортикостероидов при атопическом дерматите: консенсусное заявление Международного совета по экземе. Бр Дж Дерматол. 2018;178(3):768–775. [Бесплатная статья PMC] [PubMed] [Google Scholar]17. Ян Дж. Х. и др. Этанольные экстракты Artemisia apiacea Hance улучшили кожные поражения, подобные атопическому дерматиту, in vivo и подавили TNF-альфа/IFN-гамма(-)-индуцированную продукцию провоспалительных хемокинов in vitro. Питательные вещества.2018;10(7):806. [Бесплатная статья PMC] [PubMed] [Google Scholar]18. Ку Дж. М. и соавт. Профилактика воспаления, вызванного 2,4-динитрохлорбензолом, при поражениях кожи, подобных атопическому дерматиту, у мышей BALB/c, автор Jawoongo. BMC Комплемент Altern Med. 2018;18(1):215. [Бесплатная статья PMC] [PubMed] [Google Scholar]19. Ок С и др. Эффекты Angelica gigas Nakai в качестве противовоспалительного средства на моделях атопического дерматита in vitro и in vivo. Комплемент на основе Evid Alternat Med. 2018;2018:2450712. [Бесплатная статья PMC] [PubMed] [Google Scholar]20.Хан Х.М. и др. Улучшение действия экстракта Artemisia argyi Folium на 2,4-динитрохлорбензол-индуцированные поражения, подобные атопическому дерматиту, у мышей BALB/c. Mol Med Rep. 2016;14(4):3206–3214. [Бесплатная статья PMC] [PubMed] [Google Scholar]22. Ли М и др. Больницы традиционной монгольской, традиционной китайской и западной медицины: обзор системы и опрос пациентов об ожиданиях и восприятии качества медицинского обслуживания во Внутренней Монголии, Китай. Комплемент на основе Evid Alternat Med. 2018;2018:2698461. [Бесплатная статья PMC] [PubMed] [Google Scholar]23.Ли С и др. Выделение основных флавоноидов и эфирного масла из листьев облепихи путем одновременной дистилляции с помощью ультразвука/микроволн. R Soc Open Sci. 2018;5(7):180133. [Бесплатная статья PMC] [PubMed] [Google Scholar]24. Олас Б., Скальски Б., Улановска К. Противораковая активность облепихи [Elaeagnus rhamnoides (L.) A. Nelson] Front Pharmacol. 2018;9:232. [Бесплатная статья PMC] [PubMed] [Google Scholar]25. Олас Б. Полезные для здоровья аспекты облепихи (Elaeagnus rhamnoides (L.) А.Нельсон) масло. J Этнофармакол. 2018;213:183–190. [PubMed] [Google Scholar] 26. Диандонг Х. и др. Масло облепихи (Hippophae rhamnoides L.) защищает от ингибирующей функции естественных клеток-киллеров, вызванной хроническим стрессом, у крыс. Int J Immunopathol Pharmacol. 2016;29(1):76–83. [Бесплатная статья PMC] [PubMed] [Google Scholar]27. Сушал К. и др. Масло мякоти облепихи защищает от ишемии-реперфузии миокарда у крыс за счет активации Akt/eNOS. Фронт Фармакол. 2016;7:155. [Бесплатная статья PMC] [PubMed] [Google Scholar]30.Басу М. и др. Антиатерогенное действие масла семян облепихи (Hippophaea rhamnoides). Фитомедицина. 2007;14(11):770–777. [PubMed] [Google Scholar] 31. Ву С.М. и др. Sip-jeon-dea-bo-tang, традиционное растительное лекарственное средство, облегчает вызванную цисплатином анорексию посредством активации JAK1/STAT3-опосредованного лептина и продукции IL-6 в жировой ткани мышей. Mol Med Rep. 2016;13(4):2967–2972. [Бесплатная статья PMC] [PubMed] [Google Scholar]32. Чой Дж. Х. и соавт. Культивируемый женьшень ингибирует 2,4-динитрохлорбензол-индуцированные кожные поражения, подобные атопическому дерматиту, у мышей NC/Nga и индуцированную TNF-альфа/IFN-гамма активацию TARC в клетках HaCaT.Пищевая химическая токсикол. 2013;56:195–203. [PubMed] [Google Scholar] 33. Мизутани Н. и соавт. Интерлейкин-17А, индуцированный стромальным лимфопоэтином тимуса, участвует в развитии IgE-опосредованных поражений кожи, подобных атопическому дерматиту, у мышей. Иммунология. 2015;146(4):568–581. [Бесплатная статья PMC] [PubMed] [Google Scholar]34. Танака Х. и др. Доставка мРНК к воспалительным поражениям толстой кишки с помощью липидных наночастиц, содержащих чувствительные к окружающей среде липидоподобные материалы с каркасами из олеиновой кислоты. Гелион. 2018;4(12):e00959.[Бесплатная статья PMC] [PubMed] [Google Scholar]35. Коллинз Дж. Дж. и соавт. Олеат жирной кислоты необходим для активации врожденного иммунитета и защиты от патогенов у Caenorhabditis elegans. PLoS Патог. 2019;15(6):e1007893. [Бесплатная статья PMC] [PubMed] [Google Scholar]36. Лампронти I и др. β-Ситостерол снижает экспрессию генов хемотаксических цитокинов в эпителиальных клетках муковисцидоза бронхов. Фронт Фармакол. 2017;8:236. [Бесплатная статья PMC] [PubMed] [Google Scholar]37. Лю Р и др. β-ситостерол модулирует поляризацию макрофагов и ослабляет ревматоидное воспаление у мышей.Фарм Биол. 2019;57(1):161–168. [Бесплатная статья PMC] [PubMed] [Google Scholar]38. Фоллмер Д., Уэст В., Лефарт Э. Улучшение здоровья кожи: пероральное введение природных соединений и минералов с последствиями для кожного микробиома. Int J Mol Sci. 2018;19(10):3059. [Бесплатная статья PMC] [PubMed] [Google Scholar]39. Цицерон АФГ, Коллетти А. Влияние каротиноидов на здоровье: все ли одинаковы? Результаты клинических испытаний. Курр Фарм Дез. 2017;23(17):2422–2427. [PubMed] [Google Scholar]41. Дюбуа А. и др.Регуляция Th3-ответов и аллергического воспаления посредством сторонней активации CD8+ Т-лимфоцитов в раннем возрасте. Дж Иммунол. 2010;185(2):884–891. [PubMed] [Google Scholar]42. Гиртсман Т. и др. Природные регуляторные Т-клетки Foxp3(+) ингибируют поляризацию Th3, но смещены в сторону подавления воспаления легких, вызванного Th27. Дж. Лейкок Биол. 2010;88(3):537–546. [Бесплатная статья PMC] [PubMed] [Google Scholar]44. Лейва-Кастильо Дж. М. и соавт. TSLP, продуцируемый кератиноцитами, способствует сенсибилизации аллергеном через кожу и тем самым вызывает атопический марш у мышей.Джей Инвест Дерматол. 2013;133(1):154–163. [PubMed] [Google Scholar]46. Чжан X и др. TIM-4 по-разному экспрессируется в различных субпопуляциях дендритных клеток в коже и дренирующих кожу лимфатических узлах и контролирует гомеостаз клеток Лангерганса кожи. Онкотаргет. 2016;7(25):37498–37512. [Бесплатная статья PMC] [PubMed] [Google Scholar]47. Кумкате С. и др. Клетки Лангерганса CD207+ составляют небольшую популяцию кожных антигенпрезентирующих клеток в дренирующих лимфатических узлах после контакта с Schistosoma mansoni.Int J Паразитол. 2007;37(2):209–220. [Бесплатная статья PMC] [PubMed] [Google Scholar]48. Гайзер М.Р. и соавт. Молекула адгезии эпителиальных клеток, ассоциированная с раком (EpCAM; CD326), обеспечивает подвижность и миграцию эпидермальных клеток Лангерганса in vivo. Proc Natl Acad Sci U S A. 2012;109(15):E889–E897. [Бесплатная статья PMC] [PubMed] [Google Scholar]49. Натараджан К. и др. Роль молекулярной гибкости в презентации антигена и передаче сигналов, опосредованной Т-клеточным рецептором. Фронт Иммунол. 2018;9:1657. [Бесплатная статья PMC] [PubMed] [Google Scholar]51.Киннер Г. и соавт. Диаметральная роль OX40 в ответе CD4+ Т-клеток эффектора/памяти и регуляторных Т-клеток на аллоантиген. Дж Иммунол. 2013;191(3):1465–1475. [PMC free article] [PubMed] [Google Scholar]

Облепиховое масло

Облепиховое масло — прекрасное ранозаживляющее и противовоспалительное средство.

Часто облепиховое масло применяют как поливитаминное средство, при гипо- и авитаминозах, а также астении у взрослых по 1 чайной ложке за полчаса до еды.

В народной медицине облепиховое масло всегда ценилось как обезболивающее, нормализующее артериальное давление, снижающее риск тромбообразования, препятствующее образованию на стенках сосудов опасных холестериновых бляшек, укрепляющее иммунитет, повышающее защитные функции организма. Масло готовили в русской печи из кисловатых ярко-оранжевых плодов облепихи и применяли для лечения труднозаживающих язв и ран, в том числе желудка, кровоточивости десен, авитаминоза.

Рекомендуется применение у людей, склонных к частым вирусным инфекциям, страдающих хроническими воспалительными процессами после оперативных вмешательств, в этом случае облепиховое масло действует как неспецифический имуностимулятор, и способствует восстановлению тканей, также употребляется внутрь перед едой путем одна чайная ложка. Для укрепления верхних дыхательных путей: риниты, фарингиты, тонзиллиты, гаймориты, а также при респираторно-вирусных инфекциях местно обрабатывают слизистую носа и полости рта.

Масло облепихи применяют при болезнях желудочно-кишечного тракта: гастритах, язвах желудка и двенадцатиперстной кишки, колитах, запорах, пониженной двигательной активности кишечника, токсических поражениях печени, панкреатите, опухолях и др. В этом Делается акцент на противовоспалительных и ранозаживляющих свойствах облепихового масла, которое применяют внутрь, по чайной ложке перед едой и в виде микроклизм.

В хирургической практике облепиховое масло применяют после оперативных вмешательств на пищеводе, желудке, тонкой и толстой кишке.Как ранозаживляющее средство послеоперационных швов и ран. Кроме того, и наружно: ожоги (термические, солнечные, химические, лучевые), фурункулы, свищи, язвы на коже, абсцессы и др.

В дерматологии для интенсификации роста волос, быстрого заживления ран любой этиологии, ссадины, псориаз, нейродермит. Особенно важно учитывать, что чем раньше началось применение облепихового масла, тем меньше образуются рубцы или они бывают не такими грубыми.

В косметологии при проблемной коже лица, рук, тела, его применение особенно полезно при

сухой коже, чтобы снять шелушение, способствует устранению угревой сыпи (масло облепиховое

богато веществами, имеющими бактерицидное, противовоспалительное и антисептическое действие).Улучшает состояние волос и кожи головы, укрепляет волосяные луковицы, препятствует выпадению волос при себорее, стимулирует рост волос, придавая им блеск и шелковистость.

В стоматологии при стоматитах, ранениях слизистой полости рта, пародонтите, пульпитах.

В офтальмологии доказана высокая эффективность масла облепихи при язвах и дефектах роговицы, кератитах, конъюнктивитах, ожогах глаз, в том числе химических и лучевых.

В гинекологии применяется местно, при эрозиях, язвах слизистой влагалища и шейки матки,

кольпитах, а также других воспалительных заболеваниях или травматических поражениях, в виде

тампонов, пропитанных облепиховым маслом.

При онкологических заболеваниях масло облепихи помогает легче переносить химиотерапию и

усиливает лечебное действие цитостатиков.

Масло облепиховое изготовлено по технологии холодного отжима, что позволяет сохранить все полезные свойства и природное качество продукта.

Срок действия — 12 месяцев.

Масло облепихи — ингредиент, о необходимости которого вы не подозревали

Может показаться, что каждую неделю в блоке появляется новое «это» масло.У нас было аргановое, шиповниковое, сквалановое, кокосовое, оливковое масло… список можно продолжать и продолжать. Но позвольте нам познакомить вас с новейшим трендовым маслом, которое стоит попробовать: масло облепихи. Если вы ищете увлажняющее масло с высоким содержанием антиоксидантов, это может быть для вас. Мы даже осмелились бы сказать, что облепиховое масло — это ингредиент для ухода за кожей, которого так не хватало вашей коже. Это может быть смелым заявлением, но мы думаем, что вы согласитесь, узнав о преимуществах этого главного ингредиента.

Познакомьтесь с экспертом

  • Ванесса Коппола, FNP-BC, сертифицированная практикующая медсестра и специалист по эстетической хирургии, а также владелица Bare Aesthetic Medical Spa.
  • Доктор Мариса Гаршик, доктор медицинских наук, сертифицированный дерматолог и клинический доцент Корнельского университета.
  • Доктор Орит Марковиц, доктор медицинских наук, сертифицированный дерматолог и основатель Markowitz Medical.

Чтобы получить оценку 411 по всем продуктам облепихового масла, в том числе по его применению и всем преимуществам, мы обратились за помощью к сертифицированным дерматологам, доктору В.Мариса Гаршик и доктор Орит Марковиц, а также сертифицированная практикующая медсестра Ванесса Коппола. Читайте дальше, чтобы узнать все подробности об этом легком, но невероятно эффективном масле.

Масло облепихи

Тип ингредиента: Увлажняющее и увлажняющее средство

Основные преимущества: Обеспечивает увлажнение, выравнивает тон кожи и сокращает тонкие линии и морщины.

Для кого предназначен: Для большинства типов кожи

Как часто можно использовать: Один раз в день

Хорошо работает с: Большинство ингредиентов

Не использовать с: Ингредиенты неизвестны с которым его нельзя использовать, хотя вы всегда должны обращать внимание на то, как новый продукт взаимодействует с вашей существующей рутиной.

Что такое облепиховое масло?

Несмотря на название, облепиха родом не из моря. «Облепиха (Hippophaes rhamnoides), также называемая сибирским ананасом, представляет собой цветущий кустарник или дерево, которое производит ягоды, которые можно подвергать холодному отжиму в мякоть или масло», — объясняет Коппола. «Растение произрастает в Европе, на Кавказе, в Малой и Средней Азии, Сибири, Китае и Тибете». Одна из главных причин, почему он стал таким популярным в последнее время? «Было обнаружено, что ягоды облепихи содержат в 10 раз больше витамина С, чем апельсин, и являются третьим по величине источником витамина Е среди растений», — говорит Гаршик.По сути, облепиховое масло — это новое средство для сияния вашей мечты.

Есть исследования, которые предполагают эффективность масла облепихи при приеме внутрь, но необходимы более масштабные клинические исследования, чтобы подтвердить эти утверждения. «Они приветствуются как имеющие большие антиоксидантные свойства, а также потенциальные дерматологические и другие преимущества для здоровья, такие как потенциальное благотворное влияние на желудок, сердце и печень», — объясняет Коппола. «Эти результаты, однако, должны быть подтверждены дальнейшими более крупными клиническими исследованиями.В настоящее время ведутся исследования по местному применению облепихового масла в дерматологических и космецевтических целях, которые в этом отношении кажутся относительно безопасными и более эффективными, чем пероральные формы.»

Польза масла облепихи для кожи

Богат антиоксидантами: Если вы хотите бороться с надоедливыми свободными радикалами, стоит добавить облепиховое масло в свой рацион. «Он богат витамином С, витамином А, альфа- и бета-каротином, витаминами В1, В2 и В6, витамином Е, жирными кислотами и флавоноидами, омега-3, 6, 9 и редчайшей омега-7, а также около 190 биологически активных соединений. », — говорит Коппола.

Увлажняет кожу, регулируя уровень масла: Масло облепихи также помогает сохранить кожу красивой и увлажненной. «Он может помочь в качестве увлажняющего ингредиента, поскольку содержит линолевую кислоту, которая естественным образом содержится в кожном сале, поэтому он может помочь регулировать уровень влажности и в целом помочь с увлажнением», — объясняет Гаршик.

Улучшает тон кожи: Масло облепихи также может выравнивать тон кожи и устранять поствоспалительную гиперпигментацию. «Масло облепихи может улучшить общий тонус и текстуру кожи, а также общую эластичность кожи», — добавляет Гаршик.

Предотвращает потерю влаги: Сухая кожа плюс масло облепихи равнозначно паре, заключенной на небесах, благодаря способности ингредиента предотвращать потерю влаги. «Это помогает предотвратить трансэпидермальную потерю воды, что помогает коже поддерживать свой липидный барьер», — объясняет Коппола.

Потенциально антибактериальное, противогрибковое и антипсориатическое: Коппола говорит, что исследования продолжаются, но предварительные исследования показывают, что облепиховое масло потенциально обладает антибактериальными, противогрибковыми, антиактиническими и антипсориатическими свойствами.

Уменьшает тонкие линии и морщины: Благодаря богатому содержанию антиоксидантов, жирных кислот и витаминов облепиховое масло также может помочь уменьшить появление тонких линий и морщин. «Это антиоксидант, поэтому он обладает некоторыми антивозрастными свойствами», — добавляет Марковиц.

Помогает укротить жирные волосы: В качестве бонуса масло облепихи можно использовать для регулирования жирности волос и кожи головы. «Его можно использовать для волос, чтобы устранить избыток кожного сала, не высушивая волосы», — говорит Гаршик.

Побочные эффекты масла облепихи

Облепиховое масло относительно безопасно в использовании, и большинство типов кожи могут использовать его без каких-либо проблем. Однако, если у вас склонная к акне кожа, вы можете сначала протестировать ее. «Нет исследований, показывающих, что у него есть компонент контактного дерматита или раздражающего дерматита», — объясняет Марковиц. «Хотя многие масла могут вызывать раздражение, я не вижу никаких указаний на то, что вам следует их избегать. Но, конечно, любой продукт на основе масла с линолевой кислотой или продуктом жирной кислоты в нем может быть не лучшим для склонных к акне. кожа.Гаршик добавляет: «Несмотря на то, что облепиховое масло не вызывает акне, важно выбрать некомедогенную формулу продукта, чтобы оно не закупоривало поры».

Коппола предупреждает, что если вы планируете сделать какую-либо операцию или лечение лица, вам лучше воздержаться от нее за несколько недель до процедуры. «В некоторых исследованиях было показано, что масло облепихи продлевает кровотечение и синяки, поэтому его следует избегать перед любыми инвазивными процедурами как минимум за две недели, чтобы избежать каких-либо осложнений», — объясняет она.

Как использовать масло облепихи для кожи

Масло облепихи довольно универсально и может использоваться как отдельно, так и в составе увлажняющих средств, кремов для глаз или смесей масел. Чтобы использовать отдельно, добавьте несколько капель на ладони и нанесите перед нанесением солнцезащитного крема утром или в качестве последнего шага вашей рутины перед сном. «Безопасно использовать один раз в день», — говорит Гаршик. «В зависимости от состава его можно наносить в виде масла, которое можно наносить после увлажняющего крема для закрепления влаги, или его можно включать в очищающее средство, и в этом случае это будет первый шаг в уходе за кожей.Если это сыворотка, ее лучше всего наносить после очищения и перед увлажнением.»

Лучшие продукты с маслом облепихи

Цветоведение Total Eye Укрепляющий и Восстанавливающий Крем $95.00

Магазин

Этот увлажняющий крем для глаз — фаворит Garshick’s. «Как новейший крем для глаз от Colorescience, этот увлажняющий крем использует увлажнители, такие как глицерин и масло плодов облепихи, [а также] смягчающие средства, такие как масло семян луговой пены и сквалан, для поддержки кожного барьера и улучшения общей текстуры кожи под глазами. кожи», — объясняет она.«Он также включает в себя комплекс Total Eye Complex, который укрепляет кожу под глазами и устраняет обесцвечивание, а также кофеин, который помогает уменьшить общую отечность. Он безопасен даже для людей с чувствительной кожей, поскольку не содержит парабенов. фталаты и синтетические отдушки».

Обычный 100% органическое масло плодов облепихи первого отжима $15.00

Магазин

И Коппола, и Гаршик рекомендовали это недорогое облепиховое масло для ежедневного увлажнения кожи.«Это 100% чистое масло облепихи — доступный вариант, чтобы получить преимущества масла облепихи, включая увлажняющие и антиоксидантные свойства», — говорит Гаршик. «Он содержит различные жирные кислоты, включая пальмитолеиновую кислоту, пальмитиновую кислоту, стеариновую кислоту, олеиновую кислоту, линоленовую кислоту и линолевую кислоту, в дополнение к антиоксидантам, включая каротиноиды витамина Е и ликопин. Вместе эти ингредиенты помогают защитить кожу от повреждения свободными радикалами, в то время как одновременно уменьшая сухость и помогая поддерживать кожный барьер.Он не только делает кожу мягкой и гладкой, но также помогает улучшить общую текстуру и тон.»

Веледа Увлажняющее масло для красоты и тела — облепиха $21.00

Магазин

Гаршик и Коппола любят это легкое масло, которое увлажняет и разглаживает кожу. Гаршик рекомендует использовать его ежедневно после душа, чтобы зафиксировать влагу. Его можно использовать на любом участке тела, в том числе на ногах, чтобы смягчить кожу.

Оморовича Чудо-масло для лица 125 долларов.00

Магазин

Это масло — еще один фаворит от Garshick, который рекомендует его всем, кто хочет уменьшить признаки старения. «Облепиха уменьшает сухость и увлажняет кожу, а масло шиповника и бакучиол вместе помогают регулировать обновление клеток кожи, улучшая внешний вид тонких линий и сводя к минимуму раздражение», — объясняет она.

Фармация Honey Grail Ультраувлажняющее масло для лица 48,00 долларов США

Магазин

Это легкое масло для лица невероятно легко наносится и использует силу облепихи в сочетании с гречишным медом для одновременного увлажнения и успокоения кожи.

Похожие записи

При гормональном сбое можно ли похудеть: как похудеть при гормональном сбое

Содержание Как похудеть после гормональных таблетокЧто такое гормональные таблеткиПочему прием гормонов ведет к избыточному весу (adsbygoogle = window.adsbygoogle || []).push({}); […]

Гипотензивные средства при гиперкалиемии: Гипотензивные средства при гиперкалиемии — Давление и всё о нём

Содержание Препараты, применяемые для лечения гипертонической болезни | Илларионова Т.С., Стуров Н.В., Чельцов В.В.Основные принципы антигипертензивной терапииКлассификация Агонисты имидазолиновых I1–рецепторов […]

Прикорм таблица детей до года: Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственном

Содержание Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственномКогда можно и нужно вводить прикорм грудничку?Почему […]

Добавить комментарий

Ваш адрес email не будет опубликован.