Лдг маркер: Лактатдегидрогеназа (ЛДГ) общая

alexxlab Разное

Содержание

Лактатдегидрогеназа (ЛДГ) общая

Лактатдегидрогеназа (ЛДГ) общая – внутриклеточный гликолитический фермент, который участвует в обратимом превращении лактата в пируват и содержится в большинстве тканей организма.

Синонимы русские

Дегидрогеназа молочной кислоты.

Синонимы английские

Lactate dehydrogenase, Total, Lactic dehydrogenase, LDH, LD.

Метод исследования

УФ кинетический тест.

Единицы измерения

Ед/л (единица на литр).

Какой биоматериал можно использовать для исследования?

Венозную кровь.

Как правильно подготовиться к исследованию?

  • Не принимать пищу в течение 12 часов до исследования.
  • Исключить физическое и эмоциональное перенапряжение за 30 минут до исследования.
  • Не курить в течение 30 минут до исследования.

Общая информация об исследовании

Лактатдегидрогеназа (ЛДГ) – цинксодержащий внутриклеточный фермент, который катализирует окисление молочной кислоты в пируват и содержится практически во всех клетках организма. ЛДГ наиболее активна в скелетной мускулатуре, сердечной мышце, почках, печени и эритроцитах.

Существует пять разных форм (изоферментов) ЛДГ, которые отличаются молекулярной структурой и расположением в организме. От того, какая из пяти преобладает, зависит основной способ окисления глюкозы – аэробный (до CO2 и H2O) или анаэробный (до молочной кислоты). Подобное различие обусловлено разной степенью родства того или иного изофермента и пировиноградной кислоты. Для миокарда и мозговой ткани основной является ЛДГ-1, для эритроцитов, тромбоцитов, почечной ткани — ЛДГ-1 и ЛДГ-2. В легких, селезенке, щитовидной и поджелудочной железах, надпочечниках, лимфоцитах преобладает ЛДГ-3. ЛДГ-4 находится во всех тканях с ЛДГ-3, а также в гранулоцитах, плаценте и мужских половых клетках, в которых содержится и ЛДГ-5. Изоферментная активность в скелетных мышцах (в порядке убывания): ЛДГ-5, ЛДГ-4, ЛДГ-3. Для печени наиболее характерен изофермент ЛДГ-5, меньшая активность у ЛДГ-4. В норме в сыворотке крови все фракции фермента определяются с небольшой активностью в составе суммарного показателя – общей ЛДГ. Их активность в крови распределяется следующим образом: ЛДГ-2 > ЛДГ-1 > ЛДГ-3 > ЛДГ-4 > ЛДГ-5.

При заболеваниях, сопровождающихся повреждением тканей и разрушением клеток, активность ЛДГ в крови повышается. В связи с этим она является важным маркером тканевой деструкции. Несмотря на то что увеличение активности фермента не указывает на какую-то определенную болезнь, его определение в комплексе с другими лабораторными анализами помогает в диагностике инфаркта легкого, мышечной дистрофии и гемолитической анемии. Повышенная активность ЛДГ может выявляться у новорождённых, беременных и после интенсивных физических нагрузок.

Ранее совместные анализы на ЛДГ, аспартатаминотрансферазу и креатинкиназу широко использовались в диагностике инфаркта миокарда. Сейчас для этой цели определяют уровень тропонина как более специфического маркера повреждения сердечной мышцы. Но исследование активности ЛДГ остается вспомогательным анализом при дифференциальной диагностике болевого синдрома в грудной клетке. У больных стенокардией активность фермента не изменяется, но при инфаркте миокарда начинает возрастать через 8-10 часов с максимумом в первые 24-48 часов после сердечного приступа и возвращается к норме через 10-12 дней. Повышение ЛДГ при нормальной активности АСТ через 1-2 дня после боли в грудной клетке указывает на инфаркт легкого.

При дифференциальной диагностике миопатий данный анализ помогает уточнить патофизиологические механизмы заболевания. Так, при нарушении мышечной функции, связанной с нейрогенными заболеваниями, ЛДГ не повышается, но при повреждении мышц из-за эндокринных и метаболических патологий активность ЛДГ увеличивается.

Активность ЛДГ в крови может возрастать вследствие многих злокачественных новообразований, при эффективном лечении она снижается, что иногда применяют для динамического наблюдения за онкологическими больными.

Для чего используется исследование?

  • Для диагностики острого или хронического повреждения тканей при комплексном обследовании пациента.
  • Для дифференциальной диагностики заболеваний при резкой боли в грудной клетке (инфаркт миокарда, стенокардия, инфаркт легкого).
  • Чтобы выявлять заболевания, сопровождающиеся гемолизом эритроцитов.
  • В целях наблюдения за течением онкологических заболеваний при терапии.
  • Для исследования патологий печени и почек.
  • Для диагностики поражений мышечной ткани.

Когда назначается исследование?

  • При подозрении на острое или хроническое повреждение ткани и клеток в организме.
  • При комплексном профилактическом обследовании пациента.
  • При наблюдении за течением некоторых хронических заболеваний (мышечной дистрофии, гемолитических анемий, заболеваний печени, почек), онкологической патологии.

Что означают результаты?

Референсные значения

Возраст, пол

Референсные значения

1 — 3 года

3 — 6 лет

6 — 12 лет

12 — 17 лет

> 17 лет

женский

135 — 214 Ед/л

мужской

135 — 225 Ед/л

Причины повышения активности лактатдегидрогеназы общей:

  • инфаркт миокарда,
  • легочная эмболия и инфаркт легкого,
  • заболевания крови, сопровождающиеся гемолизом (гемолитическая, пернициозная, мегалобластическая, серповидно-клеточная анемии, эритремия),
  • злокачественные новообразования различных локализаций (рак яичек, рак печени, лимфома, метастазы в костную ткань и печень и т. д.),
  • лейкозы,
  • патология печени (вирусные и токсические гепатиты, цирроз печени, обтурационная желтуха, алкогольная болезнь печени),
  • болезни почек (инфаркт почки, гломерулонефрит, пиелонефрит),
  • патология мышц (мышечная дистрофия, травма, атрофия),
  • переломы костей,
  • застойная сердечная недостаточность, острая коронарная недостаточность (без инфаркта), миокардит (умеренное повышение фермента),
  • инфекционный мононуклеоз,
  • инфаркт кишечника,
  • острый панкреатит,
  • инсульт,
  • судорожный припадок,
  • белая горячка,
  • эклампсия,
  • травматический шок,
  • тяжелые состояния, сопровождающиеся гипоксией, гипер- и гипотермией,
  • ожоговая болезнь,
  • пневмоцистная пневмония,
  • преждевременная отслойка плаценты,
  • гипотиреоз.

Что может влиять на результат?

К повышению результата могут приводить:

  • интенсивные физические нагрузки незадолго до исследования,
  • наличие у пациента протезированного клапана сердца (гемолиз эритроцитов вследствие повреждения клеток створками клапана),
  • применение электроимпульсной терапии незадолго до исследования,
  • гемодиализ (в связи с удалением ингибиторов фермента – мочевины во время процедуры),
  • большое количество тромбоцитов (тромбоцитоз),
  • некоторые заболевания кожи,
  • лекарственные средства, повышающие активность ЛДГ (анестетики, аспирин, вазопрессин, вальпроевая кислота, наркотики, прокаинамид, этанол, амиодарон, анаболические стероиды, верапамил, изотретиноин, каптоприл, хлорамфеникол, кодеин, дапсон, дилтиазем, интерферон-альфа, интерлейкин-2, некоторые антибактериальные и противогрибковые препараты, неспецифические противовоспалительные препараты, пеницилламин, стрептокиназа, тиопентал, фуросемид, метотрексат, сульфасалазин, симвастатин, такролимус).

Возможные причины снижения результата:

  • присутствие оксалатов и мочевины, ингибирующих фермент,
  • лекарственные средства, снижающие активность ЛДГ (амикацин, аскорбиновая кислота, гидроксимочевина, дофибрат, эналаприл, метронидазол, налтрексон, противосудорожные препараты, цефотаксим).

ЛДГ (Лактатдегидрогеназа, L-лактат: НАД+Оксидоредуктаза, Lactate dehydrogenase, LDH)

Что такое ЛДГ (Лактатдегидрогеназа, L-лактат: НАД+Оксидоредуктаза, Lactate dehydrogenase, LDH)?

Лактатдегидрогеназа (ЛДГ) — это фермент, который участвует в выработке энергии и обнаруживается почти во всех клетках организма. Самое большое количество ЛДГ находится в клетках сердца, печени, мышц, почек, легких и в клетках крови.

В норме уровень ЛДГ в сыворотке крови низкий. При повреждении и/или разрушении клеток уровень ЛДГ повышается, что отражается в результатах данного теста. Однако повышение уровня ЛДГ не является специфичным, то есть установить точную локализацию поражения только по этому показателю нельзя.

Для чего определяют уровень АЛТ в крови?

ЛДГ может использоваться для отслеживания динамики тяжелых состояний, например, гемолитической анемии, мышечной дистрофии или тяжелых инфекций – уменьшение показателя в динамике сигнализирует об эффективности назначенной терапии.

Периодическое измерение ЛДГ необходимо для контроля некоторых видов лечения, например, химиотерапии злокачественных опухолей, когда снижающийся уровень этого показателя свидетельствует об эффективности терапии.

При каких заболеваниях повышается уровень АЛТ в крови?

ЛДГ повышается при инфаркте миокарда, инсульте, гемолизе (разрушении эритроцитов), инфекционных заболеваниях (инфекционном мононуклеозе, менингите, энцефалите и др.), сепсисе (крайне тяжелое состояние, когда инфекционный процесс приводит к нарушению работы многих органов – полиорганной недостаточности), остром повреждении печени, почек, мышечной травме, переломах костей, различных видах онкологических заболеваний, панкреатите (воспалительном поражении поджелудочной железы) и т.д.

Таким образом, для точной диагностики конкретного заболевания врач, обнаруживший повышение ЛДГ, вероятнее всего, назначит дополнительное обследование в соответствии с жалобами, историей заболевания и данными осмотра. Например, при подозрении на поражение печени и установленном повышении уровня ЛДГ дополнительными исследованиями станут показатели АЛТ, АСТ, в некоторых случаях – щелочной фосфатазы (ЩФ). При подозрении на инфаркт миокарда целесообразно исследовать уровней кардиоспецифичных ферментов, таких как тропонин, миоглобин, креатинкиназа (КФК).

Почему результат анализа может быть некорректным?

Если при подготовке к исследованию были соблюдены все рекомендации, то его результат будет корректным. Однако бывают ситуации, когда человек не может отказаться от приема тех или иных препаратов, а эти препараты способны исказить результат. Например, средства, содержащие ацетилсалициловую кислоту, и некоторые противовоспалительные лекарства могут завысить уровень лактатдегидрогеназы в сыворотке крови. Об их приеме нужно проконсультироваться с врачом и по возможности отменить за 2-3 дня до сдачи анализа.

Правила подготовки к анализу крови для определения уровня ЛДГ 

Взятие крови предпочтительно проводить утром натощак, после 8-14 часов ночного периода голодания (воду пить можно), допустимо днем через 4 часа после легкого приема пищи. Накануне исследования необходимо исключить повышенные психоэмоциональные и физические нагрузки (спортивные тренировки), приём алкоголя.

Интерпретация результатов исследований содержит информацию для лечащего врача и не является диагнозом. Информацию из этого раздела нельзя использовать для самодиагностики и самолечения. Точный диагноз ставит врач, используя как результаты данного обследования, так и нужную информацию из других источников: анамнеза, результатов других обследований и т.д.

Трактовка результатов анализа крови на ЛДГ

Единицы измерения: Ед/л.

Референсные значения

Возраст

Уровень ЛДГ, Ед/л

до 1 года

< 451

от 1 года до 3 лет

< 344

от 3 до 6 лет

< 314

от 6 до 12 лет

< 332

от 12 до 17 лет

< 279

более 17 лет

125-220


Повышение значений 

  1. Патология печени (вирусные и токсические гепатиты, механическая желтуха, цирроз печени). 
  2. Инфаркт миокарда и инфаркт лёгкого. 
  3. Заболевания системы крови (гемолитическая, пернициозная, мегалобластная и серповидно-клеточная анемии, острый лейкоз). 
  4. Злокачественные новообразования различных органов. 
  5. Заболевания скелетных мышц (травма, атрофия). 
  6. Патология почек (гломерулонефриты, пиелонефриты, инфаркт почки и т. п). 
  7. Любые патологические процессы, которые сопровождаются разрушением клеток и потерей цитоплазмы (травматический шок, гемолиз, обширные ожоги, гипоксия, крайняя гипотермия и т. д.). 
  8. Острый панкреатит. 
  9. Приём алкоголя и некоторых лекарственных средств (например, кофеин, анестетики, цефалоспорины, нестероидные противовоспалительные средства, сульфаниламиды).

Лактатдегидрогеназа (ЛДГ) общая: исследования в лаборатории KDLmed

Лактатдегидрогеназа (ЛДГ) общая – внутриклеточный гликолитический фермент, который участвует в обратимом превращении лактата в пируват и содержится в большинстве тканей организма.

Синонимы русские

Дегидрогеназа молочной кислоты.

Синонимы английские

Lactate dehydrogenase, Total, Lactic dehydrogenase, LDH, LD.

Метод исследования

УФ кинетический тест.

Единицы измерения

Ед/л (единица на литр).

Какой биоматериал можно использовать для исследования?

Венозную кровь.

Как правильно подготовиться к исследованию?

  • Не принимать пищу в течение 12 часов до анализа.
  • Исключить физическое и эмоциональное перенапряжение за 30 минут до исследования.
  • Не курить в течение 30 минут до сдачи крови.

Общая информация об исследовании

Лактатдегидрогеназа (ЛДГ) – цинксодержащий внутриклеточный фермент, который катализирует окисление молочной кислоты в пируват и содержится практически во всех клетках организма. ЛДГ наиболее активна в скелетной мускулатуре, сердечной мышце, почках, печени и эритроцитах.

Существует пять разных форм (изоферментов) ЛДГ, которые отличаются молекулярной структурой и расположением в организме. От того, какая из пяти преобладает, зависит основной способ окисления глюкозы – аэробный (до CO2 и H2O) или анаэробный (до молочной кислоты). Подобное различие обусловлено разной степенью родства того или иного изофермента и пировиноградной кислоты. Для миокарда и мозговой ткани основной является ЛДГ-1, для эритроцитов, тромбоцитов, почечной ткани — ЛДГ-1 и ЛДГ-2. В лёгких, селезёнке, щитовидной и поджелудочной железах, надпочечниках, лимфоцитах преобладает ЛДГ-3. ЛДГ-4 находится во всех тканях с ЛДГ-3, а также в гранулоцитах, плаценте и мужских половых клетках, в которых содержится и ЛДГ-5. Изоферментная активность в скелетных мышцах (в порядке убывания): ЛДГ-5, ЛДГ-4, ЛДГ-3. Для печени наиболее характерен изофермент ЛДГ-5, меньшая активность у ЛДГ-4. В норме в сыворотке крови все фракции фермента определяются с небольшой активностью в составе суммарного показателя – общей ЛДГ. Их активность в крови распределяется следующим образом: ЛДГ-2 > ЛДГ-1 > ЛДГ-3 > ЛДГ-4 > ЛДГ-5.

При заболеваниях, сопровождающихся повреждением тканей и разрушением клеток, активность ЛДГ в крови повышается. В связи с этим она является важным маркером тканевой деструкции. Несмотря на то что увеличение активности фермента не указывает на какую-то определённую болезнь, его определение в комплексе с другими лабораторными анализами помогает в диагностике инфаркта лёгкого, мышечной дистрофии и гемолитической анемии. Повышенная активность ЛДГ может выявляться у новорождённых, беременных и после интенсивных физических нагрузок.

Ранее совместные анализы на ЛДГ, аспартатаминотрансферазу и креатинкиназу широко использовались в диагностике инфаркта миокарда. Сейчас для этой цели определяют уровень тропонина как более специфического маркера повреждения сердечной мышцы. Но исследование активности ЛДГ остается вспомогательным анализом при дифференциальной диагностике болевого синдрома в грудной клетке. У больных стенокардией активность фермента не изменяется, но при инфаркте миокарда начинает возрастать через 8-10 часов с максимумом в первые 24-48 часов после сердечного приступа и возвращается к норме через 10-12 дней. Повышение ЛДГ при нормальной активности АСТ через 1-2 дня после боли в грудной клетке указывает на инфаркт лёгкого.

При дифференциальной диагностике миопатий данный анализ помогает уточнить патофизиологические механизмы заболевания. Так, при нарушении мышечной функции, связанной с нейрогенными заболеваниями, ЛДГ не повышается, но при повреждении мышц из-за эндокринных и метаболических патологий активность ЛДГ увеличивается.

Активность ЛДГ в крови может возрастать вследствие многих злокачественных новообразований, при эффективном лечении она снижается, что иногда применяют для динамического наблюдения за онкологическими больными.

Для чего используется исследование?

  • Для диагностики острого или хронического повреждения тканей при комплексном обследовании пациента.
  • Для дифференциальной диагностики заболеваний при резкой боли в грудной клетке (инфаркт миокарда, стенокардия, инфаркт лёгкого).
  • Чтобы выявлять заболевания, сопровождающиеся гемолизом эритроцитов.
  • В целях наблюдения за течением онкологических заболеваний при терапии.
  • Для исследования патологий печени и почек.
  • Для диагностики поражений мышечной ткани.

Когда назначается исследование?

  • При подозрении на острое или хроническое повреждение ткани и клеток в организме.
  • При комплексном профилактическом обследовании пациента.
  • При наблюдении за течением некоторых хронических заболеваний (мышечной дистрофии, гемолитических анемий, заболеваний печени, почек), онкологической патологии.

Что означают результаты?

Референсные значения

Возраст, пол

Референсные значения

1 — 3 года

3 — 6 лет

6 — 12 лет

12 — 17 лет

> 17 лет

женский

135 — 214 Ед/л

мужской

135 — 225 Ед/л

Причины повышения активности лактатдегидрогеназы общей:

  • инфаркт миокарда,
  • лёгочная эмболия и инфаркт лёгкого,
  • заболевания крови, сопровождающиеся гемолизом (гемолитическая, пернициозная, мегалобластическая, серповидно-клеточная анемии, эритремия),
  • злокачественные новообразования различных локализаций (рак яичек, рак печени, лимфома, метастазы в костную ткань и печень и т. д.),
  • лейкозы,
  • патология печени (вирусные и токсические гепатиты, цирроз печени, обтурационная желтуха, алкогольная болезнь печени),
  • болезни почек (инфаркт почки, гломерулонефрит, пиелонефрит),
  • патология мышц (мышечная дистрофия, травма, атрофия),
  • переломы костей,
  • застойная сердечная недостаточность, острая коронарная недостаточность (без инфаркта), миокардит (умеренное повышение фермента),
  • инфекционный мононуклеоз,
  • инфаркт кишечника,
  • острый панкреатит,
  • инсульт,
  • судорожный припадок,
  • белая горячка,
  • эклампсия,
  • травматический шок,
  • тяжёлые состояния, сопровождающиеся гипоксией, гипер- и гипотермией,
  • ожоговая болезнь,
  • пневмоцистная пневмония,
  • преждевременная отслойка плаценты,
  • гипотиреоз.

Что может влиять на результат?

К повышению результата могут приводить:

  • гемолиз эритроцитов в пробе крови (в связи с высокой активностью ЛДГ в клетках крови),
  • интенсивные физические нагрузки незадолго до исследования,
  • наличие у пациента протезированного клапана сердца (гемолиз эритроцитов вследствие повреждения клеток створками клапана),
  • применение электроимпульсной терапии незадолго до исследования,
  • гемодиализ (в связи с удалением ингибиторов фермента – мочевины во время процедуры),
  • большое количество тромбоцитов (тромбоцитоз),
  • некоторые заболевания кожи,
  • лекарственные средства, повышающие активность ЛДГ (анестетики, аспирин, вазопрессин, вальпроевая кислота, наркотики, прокаинамид, этанол, амиодарон, анаболические стероиды, верапамил, изотретиноин, каптоприл, хлорамфеникол, кодеин, дапсон, дилтиазем, интерферон-альфа, интерлейкин-2, некоторые антибактериальные и противогрибковые препараты, неспецифические противовоспалительные препараты, пеницилламин, стрептокиназа, тиопентал, фуросемид, метотрексат, сульфасалазин, симвастатин, такролимус).

Возможные причины снижения результата:

  • присутствие оксалатов и мочевины, ингибирующих фермент,
  • лекарственные средства, снижающие активность ЛДГ (амикацин, аскорбиновая кислота, гидроксимочевина, дофибрат, эналаприл, метронидазол, налтрексон, противосудорожные препараты, цефотаксим).

Важные замечания

  • Ввиду неспецифичности данного анализа его результат должен трактоваться с учётом показателей других лабораторных исследований и клинической картины заболевания.
  • В диагностике острых процессов, сопровождающихся деструкцией ткани (инфаркта, некроза), необходимо учитывать изменения активности ЛДГ в плазме в течение некоторого времени после острого эпизода болезни.
  • Определение изоферментов ЛДГ помогает уточнить локализацию патологического процесса.
  • Основным лабораторным маркером инфаркта миокарда является тропонин I, а не ЛДГ.

Также рекомендуется

Кто назначает исследование?

Терапевт, кардиолог, онколог, врач общей практики.

Литература

  • Назаренко Г.И., Кишкун А. Клиническая оценка результатов лабораторных исследований. – М.: Медицина, 2000. — 165-166.
  • Fischbach F.T., Dunning M.B. A Manual of Laboratory and Diagnostic Tests, 8th Ed. Lippincott Williams & Wilkins, 2008: 1344 p.
  • Wilson D. McGraw-Hill Manual of Laboratory and Diagnostic Tests 1st Ed Normal, Illinois, 2007: 347-348 pp.

Опухолевые маркеры. Их роль в диагностике, мониторинге и составлении прогноза

На сегодняшний день практическое значение при герминогенных опухолях яичка имеют три основных маркера: альфа- фетопротеин (АФП), бетта — субъединица хорионического гонадотропина (b-ХГ) и лактатдегидрогеназа (ЛДГ).

АФП — гликопротеин с молекулярной массой 70 кД с периодом полураспада 5-7 дней. В норме он секретируется желточным мешком, печенью и желудочно-кишечным трактом плода. У детей старше года и взрослых верхняя граница нормы концентрации АФП в сыворотке крови составляет 15 мг/мл. Увеличение ее уровня может свидетельствовать о доброкачественных заболеваниях печени, гепатоцеллюлярной карциноме, раке желудка, кишечника, желчного пузыря, поджелудочной железы и легких. Повышение концентрации АФП сыворотки крови у больных герминогенными опухолями яичка впервые было выявлено Абелевым в 1967 г. В данных новообразованиях источником АФП являются элементы эндодермального синуса.

ХГ — гликопротеин с молекулярной массой 46 кД, состоящий из двух нековалентно связанных субъединиц — a и b, и периодом полураспада 12-36 часов. ХГ вырабатывается клетками синцитиотрофобласта. У взрослых мужчин верхняя граница нормы концентрации ХГ в сыворотке крови составляет 5 Ед/л. Уровень сывороточного ХГ может быть повышен при аденокарциноме и островково- клеточных опухолях поджелудочной железы, опухолях желудочно- кишечного тракта,печени, легких, яичника, солочной железы и почек. Очень высокие концентрации ХГ отмечается при пузырных заносах и хорионкарциномах. В герминогенных опухолях он синтезируется трофобластическими структурами или гигантскими клетками синцитиотрофобласта. Уровень ХГ сыворотки крови находится в прямой зависимости от массы опухоли. Концентрация ХГ, равная 1 Ед/л, соответствует 10 000 опухолевых клеток.

ЛДГ — фермент с молекулярной массой 134 кД, периодом полужизни 24 часа, вырабатываемый гладкой, поперечно- полосатой и сердечной мышцами, а также рядом других тканей. ЛДГ имеет 5 изоизомеров, каждый из которых состоит из 4 субъединиц. ЛДГ — 1 является наиболее часто вырабатываемым опухолями яичка изоферментом. Чувствительность и специфичность этого маркера при раке яичка невысока. Концентрацию ЛДГ сыворотки крови более 2000 Ед/л можно считать реальным признаком опухоли. В основном, уровень ЛДГ используется для прогнозирования течения заболевания.

В настоящее время проводятся исследования, направленные на выявление новых опухолевых маркеров при раке яичка, таких как эритроцитарный В5 (моноклональные антитела к эритроцитам больных злокачественными опухолями), GCTM-2 (моноклональные антитела, распознающие кератин — сульфат протеогликан экстрацеллюлярного матрикса человеческих клеток эмбрионального рака), беременность — специфический гликопротеин b-1, ассоциированный с хорионкарциномой, TRA-1-60 (моноклональные антитела, ассоциированные с клеточной поверхностью клеток эмбриональной карциномы) и другие.

Определение уровня опухолевых маркеров позволяет диагностировать опухоль яичка на ранней стадии или выявить ее внегонадную локализацию, уточнить гистологическое строение опухоли, помогает определить тактику лечения и оценить его эффективность, способствует раннему выявлению рецидивов опухоли и помогает составить прогноз заболевания.

Скрининг герминогенных опухолей яичка путем определения уровня опухолевых маркеров сыворотки крови экономически не оправдан, так как отсутствие повышения их концентрации не исключает наличия опухолевого процесса. Однако использование АФП, ХГ и ЛДГ в дополнение к комплексному обследованию повышает диагностическую чувствительность как в отношении гонадных, так и внегонадных герминогенных опухолей.

Определение уровня опухолевых маркеров позволяет предполагать гистологическое строение герминогенной опухоли. В зависимости от концентрации сывороточных маркеров новообразования яичка можно разделить на две группы. В группу опухолей, не продуцирующих АФП и ХГ, относят семиномы, зрелые тератомы и эмбриональные карциномы чистого типа. Среди клеток эмбрионального рака могут содержаться гигантские клетки синцитиотрофобласта, которые вырабатывают незначительное количество ХГ, концентрация которого не преывшает 75 мМЕ/мл. К группе маркер — продуцирующих относится около 80% герминогенных опухолей: опухоли желточного мешка, вырабатывающие АФП, хорионкарциномы, секретирующие ХГ, смешанные опухоли, производящие АФП и/или ХГ (таблица 2).

Таблица 2. Концентрация опухолевых маркеров сыворотки крови у больных раком яичка в зависимости от гистологического строения опухоли

Гистологическое строение опухоли

Повышение АФП (>15мг/мл)

Повышение ХГ (>5Ед/л)

Чистая семинома

Чистый эмбриональный рак

Незрелая тератома

Тератокарцинома

+

+

Опухоль желточного мешка

+

Желточный мешок + другие элементы

+

+/-

Хорионкарцинома

+

Хорионкарцинома + другие элементы

+/-

+

Низкодифференцированный рак

+/-

+/-

Данные, касающиеся чувствительности опухолевых маркеров при различных гистологических формах герминогенных опухолей, приведены в таблице 3.

Таблица 3. Частота маркер-положительных герминогенных опухолей яичка в зависимости от гистологического строения

Гистологическое строение опухоли

Повышение концентрации АФП (>10 мг/мл)

Повышение концентрации ХГ (>5 Ед/л)

Семинома

15-20%

Зрелая тератома

0%

0%

Тератокарцинома

70-72%

55-60%

Опухоль желточного мешка

64%

0%

Хорионкарцинома

0%

100%

Смешанные опухоли

50-80%

50-60%

Учитывая принципиальные различия в лечебном подходе к семиномным и несеминомным опухолям яичка, определение уровня АФП и ХГ имеет важное практическое значение. Часто опухолевые маркеры оказываются более информативными, чем рутинное гистологическое исследование опухоли. Повышение уровня АФП сыворотки крови у больного семиномой без метастазов в печень должно расцениваться как признак наличия элементов желточного мешка в опухоли. Увеличение концентрации ХГ отмечается у 15% пациентов с семиномой вследствие наличия в опухоли несеминомных элементов или, гораздо реже, присутствия гигантских клеток синцитиотрофобласта. Если при I — II стадии семиномы уровень ХГ не превышает 200 нг/мл, то никаких модификаций лечебного подхода не требуется. Однако, в случае повышения сывороточного ХГ, наблюдаемого при небольших размерах первичной опухоли, или несопоставимом с уровнем маркера количеством гигантских клеток синцитиотрофобласта в ней, необходимо расценивать заболевание как опухоль смешанного строения и изменить схему лечения.

Опухолевые маркеры играют существенную роль в выявлении вовлечения центральной нервной системы (ЦНС) в опухолевый процесс. Так, соотношение ХГ сыворотки крови и ликвора менее, чем 60:1, свидетельствует о секреции этого маркера метастазами ХГ-продуцирующей герминогенной опухоли, локализующимися в ЦНС. Хотя нормальное соотношение не исключает наличие опухолевых очагов этой локализации.

Помимо этого, повышение уровня АФП и ХГ при наличии неизмененных яичек позволяет заподозрить внегонадную герминогенную опухоль на ранних стадиях.

Определение концентрации опухолевых маркеров сыворотки крови до и через 5-6 дней после удаления первичной опухоли позволяет уточнить клинически установленную стадию заболевания, снижая частоту ошибок на 35%.

Уровень опухолевых маркеров определяется у всех больных герминогенными опухолями в течение лечения и наблюдения через определенные промежутки времени в зависимости от степени распространенности заболевания. При I стадии рутинное определение опухолевых маркеров производится ежемесячно в течение 1-го года после орхфуникулэктомии, а затем каждые 6 месяцев во 2-й и 3-й годы. После радикального удаления опухоли уровни маркеров должны снижаться до нормальных значений в соответствии с их полупериодами жизни: АФП — менее 5 дней, ХГ — 1-2 дня. При сохранении повышенной концентрации АФП и ХГ, и увеличении полупериода жизни маркеров после удаления первичной опухоли даже при отсутствии рентгенологнических данных, свидетельствующих о диссеминации процесса, следует думать о наличии отдаленных метастазов и проводить соответствующее лечение.

При II А-В стадии герминогенных опухолей мониторинг больных после проведения специфического лечения (индукционная химиотерапия с последующей забрюшинной лимфаденэктомией или забрюшинная лимфаденэктомия с последующей адъювантной химиотерапией) должен включать определение опухолевых маркеров ежемесячно в течение 1-го года, каждые 3 месяца на протяжении второго года и 1 раз в 6 месяцев в и 3-й год.

При IIC-III стадиях герминогенных опухолей яичка скорость снижения концентрации опухолевых маркеров после химиотерапии отражает прогноз больного. Устойчивое повышение уровня АФП и ХГ, а также удлинение полупериода их жизни в первые 6 недель после химиотерапии указывает на резистентность опухоли и плохой прогноз. Сохранение положительных опухолевых маркеров сыворотки крови после проведения индукионной химиотерапии является противопоказанием к хирургическому удалению резидуальных опухолевых масс. Как правило, таким больным проводится химиотерапия второй линии. Нормализация уровня АФП и ХГ является признаком ремиссии.

Несеминомные герминогенные опухоли состоят из нескольких видов клеток, синтезирующих разные виды маркеров. В процессе лечения один или несколько маркер — продуцирующих клонов может элиминироваться. Следствием этого является изменение соотношений производимых опухолью маркеров: новообразование, не синтезировавшее ранее АФП и ХГ, может начать секретировать один или оба маркера или наоборот. Поэтому в процессе наблюдения за пациентами следует определять концентрацию как АФП, так и ХГ в сыворотке крови. Кроме того, следует учитывать, что после хирургического удаления опухолевых масс снижение уровня опухолевых маркеров отражает степень циторедукции, а после химиотерапии — только жизнеспособность маркерпродуцирующих клонов клеток.

Повышение концентрации АФП и ХГ может свидетельствовать о прогрессировании заболевания за 1-6 месяцев до клинического появления рецидива и служит основанием для начала лечения. Диагностическая чувствительность повышения АФП и ХГ при рецидивах герминогенных опухолей составляет 86% при специфичности 100% .

Нормальный уровень маркеров не может однозначно исключить прогрессирование. Рецидивная опухоль способна приобретать новые биологические свойства, например, стать маркер — отрицательной. Ложноотрицательные результаты исследования концентрации опухолевых маркеров сыворотки крови могут быть также обусловлены небо льшими размерами новообразования или наличием зрелой тератомы.

Редко наблюдаются ложноположительные результаты при определении уровня АФП и ХГ, обусловленные лизисом опухолевых клеток в ответ на интенсивную химиотерапию. Увеличение концентрации АФП, не связанное с прогрессированием заболевания, может быть обусловлено также печеночной недостаточностью.

Прогностическое значение концентрации опухолевых маркеров сыворотки крови у больных герминогенными опухолями яичка продемонстрировано в многочисленных работах. Наиболее обширным было исследование Международной группы по изучению герминогенных опухолей (IGCСCG), в которое вошли 5000 больных. На основании анализа полученных данных, включая инициальный уровень опухолевых маркеров, были разработаны критерии включения в одну из прогностических групп, приведенные выше. При этом, 5-тилетняя выживаемость у больных несеминомными опухолями в группах хорошего, умеренного и плохого прогноза составила 92%, 80% и 48% соответственно, и у пациентов с семиномой в группах хорошего и умеренного прогноза — 86% и 73% соответственно.

Сдать анализ на ЛДГ, лактатдегидрогеназу

Метод определения Лактат =>пируват (IFCC).

Исследуемый материал Сыворотка крови

Доступен выезд на дом

Онлайн-регистрация

Синонимы: Анализ крови на ЛДГ; Лактатдегидрогеназа; L-лактат; НАД+Оксидоредуктаза; Дегидрогеназа молочной кислоты.

Lactate dehydrogenase, Total; Lactic dehydrogenase; LDH; LD.

Краткая характеристика определяемого вещества Лактатдегидрогеназа

ЛДГ – цитоплазматический цинксодержащий фермент, обнаруживаемый практически во всех органах и тканях человека, концентрация его внутри клеток намного выше, чем в сыворотке крови, катализирует обратимую реакцию окисления L-лактата в пируват. Наибольшая активность отмечается в почках, печени, сердце, скелетных мышцах, поджелудочной железе, клетках крови (разные ткани различаются по изоферментному составу ЛДГ). У детей сывороточная активность фермента выше, чем у взрослых; с возрастом активность ЛДГ плавно снижается.

Что следует учесть при выполнении теста на Лактатдегидрогеназу

Показатели активности ЛДГ могут зависеть от метода исследования, поэтому в динамике исследования следует проводить в одной лаборатории с использованием того же метода. Повышенная активность ЛДГ в физиологических условиях наблюдается после интенсивных физических нагрузок, у новорожденных детей, беременных женщин.

С какой целью определяют уровень Лактатдегидрогеназы в сыворотке крови

Определение ЛДГ – один из основных ферментативных тестов в лабораторной диагностике инфаркта миокарда. Общая активность ЛДГ сыворотки крови возрастает в промежутке от 8 до 12 часов после болевого приступа, достигая максимума через 24-48 часов, остается повышенной в течение семи и более дней. Обычно наблюдается увеличение в 3-4 раза от верхнего предела референсных значений, но может быть и 10-кратное превышение. Определение ЛДГ особенно полезно для лабораторного подтверждения инфаркта миокарда через 24 и более часов после начала болевого приступа (в то время как определение креатинкиназы и креатинкиназы-МВ ценно для диагностики инфаркта на ранних сроках). Уровень ЛДГ может быть умеренно увеличен при миокардитах и сердечной недостаточности с застойными явлениями в печени. При стенокардии и перикардитах содержание ЛДГ бывает в пределах нормы. Практически всегда при достаточно выраженном гемолизе ЛДГ повышена. Увеличение сывороточной активности ЛДГ наблюдается также при мегалобластных анемиях, сопровождаемых неэффективным гемопоэзом, разрушением предшественников эритроцитов и освобождением повышенных количеств фермента. Умеренное повышение ЛДГ наблюдается при заболеваниях печени (менее выраженное, чем повышение трансаминаз), а также примерно у трети пациентов с заболеваниями почек, особенно при наличии тубулярного некроза или пиелонефрита. Повышение уровня ЛДГ в сыворотке крови обнаруживается у большинства пациентов со злокачественными заболеваниями. Особенно высокие величины активности фермента связаны с болезнью Ходжкина и злокачественными заболеваниями брюшной полости и легких. Умеренное повышение ЛДГ наблюдается при лейкемии. Увеличенные концентрации фермента находят у пациентов с прогрессивной мышечной дистрофией, особенно на ранней и промежуточной стадиях заболевания. Повышенные уровни ЛДГ отмечают при легочной эмболии.

ЛДГ (Лактатдегидрогеназа, L-лактат: НАД+Оксидоредуктаза, Lactate dehydrogenase, LDH)

Исследуемый материал Сыворотка крови

Метод определения Оптимизированный стандартизированный (DGKC) UV-тест (пируват ==> лактат).

Гликолитический фермент, участвующий в конечных этапах превращения глюкозы (катализ взаимопревращения пирувата и лактата).

Цинксодержащий фермент, локализующийся в основном в цитоплазме и обнаруживающийся практически во всех органах и тканях человека. Наибольшая активность отмечается в почках, печени, сердце, скелетных мышцах, поджелудочной железе, клетках крови. В эритроцитах её уровень в 100 раз выше, чем в сыворотке. У детей активность фермента выше, чем у взрослых, с возрастом активность ЛДГ сыворотки плавно снижается.


Показатели активности ЛДГ зависят от метода исследования. Повышенная активность ЛДГ в физиологических условиях наблюдается у беременных, новорожденных, после интенсивных физических нагрузок. Активность фермента у женщин несколько ниже, чем у мужчин. Мониторинг течения инфаркта миокарда. Рост активности ЛДГ наблюдается на 12 — 24 часу после инфаркта; максимальная активность отмечается через 24 — 48 часов. Повышенная активность фермента держится вплоть до 10 суток. Активность ЛДГ зависит от размеров очага поражения миокарда, а динамика ее снижения в процессе выздоровления — от интенсивности восстановительных процессов в сердечной мышце.

Определение активности ЛДГ позволяет дифференцировать истинный инфаркт миокарда и клинически сходные с ним приступы стенокардии: при инфаркте суммарная активность ЛДГ возрастает и в результате ее значение в несколько раз превышает нормальный уровень, в то же время даже при тяжелых приступах стенокардии уровень активности ЛДГ соответствует норме. Снижение активности фермента в постинфарктном периоде происходит в 2 раза медленнее, чем нормализация таких маркеров поражения миокарда, как креатинкиназа и АСТ, что особенно ценно для поздней диагностики поражения.

Сдать анализы — Лактатдегидрогеназа (ЛДГ) общая

Лактатдегидрогеназа (ЛДГ) общая – внутриклеточный гликолитический фермент, который участвует в обратимом превращении лактата в пируват и содержится в большинстве тканей организма.

Синонимы русские

Дегидрогеназа молочной кислоты.

Синонимы английские

Lactate dehydrogenase, Total, Lactic dehydrogenase, LDH, LD.

Метод исследования

УФ кинетический тест.

Единицы измерения

Ед/л (единица на литр).

Какой биоматериал можно использовать для исследования?

Венозную кровь.

Как правильно подготовиться к исследованию?
  • Не принимать пищу в течение 12 часов до анализа.
  • Исключить физическое и эмоциональное перенапряжение за 30 минут до исследования.
  • Не курить в течение 30 минут до сдачи крови.
Общая информация об исследовании

Лактатдегидрогеназа (ЛДГ) – цинксодержащий внутриклеточный фермент, который катализирует окисление молочной кислоты в пируват и содержится практически во всех клетках организма. ЛДГ наиболее активна в скелетной мускулатуре, сердечной мышце, почках, печени и эритроцитах.

Существует пять разных форм (изоферментов) ЛДГ, которые отличаются молекулярной структурой и расположением в организме. От того, какая из пяти преобладает, зависит основной способ окисления глюкозы – аэробный (до CO2 и h3O) или анаэробный (до молочной кислоты). Подобное различие обусловлено разной степенью родства того или иного изофермента и пировиноградной кислоты. Для миокарда и мозговой ткани основной является ЛДГ-1, для эритроцитов, тромбоцитов, почечной ткани — ЛДГ-1 и ЛДГ-2. В лёгких, селезёнке, щитовидной и поджелудочной железах, надпочечниках, лимфоцитах преобладает ЛДГ-3. ЛДГ-4 находится во всех тканях с ЛДГ-3, а также в гранулоцитах, плаценте и мужских половых клетках, в которых содержится и ЛДГ-5. Изоферментная активность в скелетных мышцах (в порядке убывания): ЛДГ-5, ЛДГ-4, ЛДГ-3. Для печени наиболее характерен изофермент ЛДГ-5, меньшая активность у ЛДГ-4. В норме в сыворотке крови все фракции фермента определяются с небольшой активностью в составе суммарного показателя – общей ЛДГ. Их активность в крови распределяется следующим образом: ЛДГ-2 > ЛДГ-1 > ЛДГ-3 > ЛДГ-4 > ЛДГ-5.

При заболеваниях, сопровождающихся повреждением тканей и разрушением клеток, активность ЛДГ в крови повышается. В связи с этим она является важным маркером тканевой деструкции. Несмотря на то что увеличение активности фермента не указывает на какую-то определённую болезнь, его определение в комплексе с другими лабораторными анализами помогает в диагностике инфаркта лёгкого, мышечной дистрофии и гемолитической анемии. Повышенная активность ЛДГ может выявляться у новорождённых, беременных и после интенсивных физических нагрузок.

Ранее совместные анализы на ЛДГ, аспартатаминотрансферазу и креатинкиназу широко использовались в диагностике инфаркта миокарда. Сейчас для этой цели определяют уровень тропонина как более специфического маркера повреждения сердечной мышцы. Но исследование активности ЛДГ остается вспомогательным анализом при дифференциальной диагностике болевого синдрома в грудной клетке. У больных стенокардией активность фермента не изменяется, но при инфаркте миокарда начинает возрастать через 8-10 часов с максимумом в первые 24-48 часов после сердечного приступа и возвращается к норме через 10-12 дней. Повышение ЛДГ при нормальной активности АСТ через 1-2 дня после боли в грудной клетке указывает на инфаркт лёгкого.

При дифференциальной диагностике миопатий данный анализ помогает уточнить патофизиологические механизмы заболевания. Так, при нарушении мышечной функции, связанной с нейрогенными заболеваниями, ЛДГ не повышается, но при повреждении мышц из-за эндокринных и метаболических патологий активность ЛДГ увеличивается.

Активность ЛДГ в крови может возрастать вследствие многих злокачественных новообразований, при эффективном лечении она снижается, что иногда применяют для динамического наблюдения за онкологическими больными.

Для чего используется исследование?
  • Для диагностики острого или хронического повреждения тканей при комплексном обследовании пациента.
  • Для дифференциальной диагностики заболеваний при резкой боли в грудной клетке (инфаркт миокарда, стенокардия, инфаркт лёгкого).
  • Чтобы выявлять заболевания, сопровождающиеся гемолизом эритроцитов.
  • В целях наблюдения за течением онкологических заболеваний при терапии.
  • Для исследования патологий печени и почек.
  • Для диагностики поражений мышечной ткани.
Когда назначается исследование?
  • При подозрении на острое или хроническое повреждение ткани и клеток в организме.
  • При комплексном профилактическом обследовании пациента.
  • При наблюдении за течением некоторых хронических заболеваний (мышечной дистрофии, гемолитических анемий, заболеваний печени, почек), онкологической патологии.
Что означают результаты?

Референсные значения

Возраст, пол Референсные значения
< 1 года < 451 Ед/л
1 — 3 года < 344 Ед/л
3 — 6 лет < 314 Ед/л
6 — 12 лет < 332 Ед/л
12 — 17 лет < 279 Ед/л
> 17 лет женский 135 — 214 Ед/л
мужской 135 — 225 Ед/л

 

Причины повышения активности лактатдегидрогеназы общей:
  • инфаркт миокарда,
  • лёгочная эмболия и инфаркт лёгкого,
  • заболевания крови, сопровождающиеся гемолизом (гемолитическая, пернициозная, мегалобластическая, серповидно-клеточная анемии, эритремия),
  • злокачественные новообразования различных локализаций (рак яичек, рак печени, лимфома, метастазы в костную ткань и печень и т. д.),
  • лейкозы,
  • патология печени (вирусные и токсические гепатиты, цирроз печени, обтурационная желтуха, алкогольная болезнь печени),
  • болезни почек (инфаркт почки, гломерулонефрит, пиелонефрит),
  • патология мышц (мышечная дистрофия, травма, атрофия),
  • переломы костей,
  • застойная сердечная недостаточность, острая коронарная недостаточность (без инфаркта), миокардит (умеренное повышение фермента),
  • инфекционный мононуклеоз,
  • инфаркт кишечника,
  • острый панкреатит,
  • инсульт,
  • судорожный припадок,
  • белая горячка,
  • эклампсия,
  • травматический шок,
  • тяжёлые состояния, сопровождающиеся гипоксией, гипер- и гипотермией,
  • ожоговая болезнь,
  • пневмоцистная пневмония,
  • преждевременная отслойка плаценты,
  • гипотиреоз.
Что может влиять на результат?

К повышению результата могут приводить:

  • гемолиз эритроцитов в пробе крови (в связи с высокой активностью ЛДГ в клетках крови),
  • интенсивные физические нагрузки незадолго до исследования,
  • наличие у пациента протезированного клапана сердца (гемолиз эритроцитов вследствие повреждения клеток створками клапана),
  • применение электроимпульсной терапии незадолго до исследования,
  • гемодиализ (в связи с удалением ингибиторов фермента – мочевины во время процедуры),
  • большое количество тромбоцитов (тромбоцитоз),
  • некоторые заболевания кожи,
  • лекарственные средства, повышающие активность ЛДГ (анестетики, аспирин, вазопрессин, вальпроевая кислота, наркотики, прокаинамид, этанол, амиодарон, анаболические стероиды, верапамил, изотретиноин, каптоприл, хлорамфеникол, кодеин, дапсон, дилтиазем, интерферон-альфа, интерлейкин-2, некоторые антибактериальные и противогрибковые препараты, неспецифические противовоспалительные препараты, пеницилламин, стрептокиназа, тиопентал, фуросемид, метотрексат, сульфасалазин, симвастатин, такролимус).

Возможные причины снижения результата:

  • присутствие оксалатов и мочевины, ингибирующих фермент,
  • лекарственные средства, снижающие активность ЛДГ (амикацин, аскорбиновая кислота, гидроксимочевина, дофибрат, эналаприл, метронидазол, налтрексон, противосудорожные препараты, цефотаксим).
Важные замечания
  • Ввиду неспецифичности данного анализа его результат должен трактоваться с учётом показателей других лабораторных исследований и клинической картины заболевания.
  • В диагностике острых процессов, сопровождающихся деструкцией ткани (инфаркта, некроза), необходимо учитывать изменения активности ЛДГ в плазме в течение некоторого времени после острого эпизода болезни.
  • Определение изоферментов ЛДГ помогает уточнить локализацию патологического процесса.
  • Основным лабораторным маркером инфаркта миокарда является тропонин I, а не ЛДГ.
Также рекомендуется
  1. Аланинаминотрансфераза (АЛТ)
  2. Аспартатаминотрансфераза (АСТ)
  3. Креатинкиназа общая
  4. Креатинкиназа MB
  5. Лактатдегидрогеназа 1, 2 (ЛДГ 1, 2 фракции)
  6. Фосфатаза щелочная общая
  7. Тропонин I
  8. Миоглобин
Кто назначает исследование?

Терапевт, кардиолог, онколог, врач общей практики.

Литература

Назаренко Г.И., Кишкун А. Клиническая оценка результатов лабораторных исследований. – М.: Медицина, 2000. — 165-166.

Fischbach F.T., Dunning M.B. A Manual of Laboratory and Diagnostic Tests, 8th Ed. Lippincott Williams & Wilkins, 2008: 1344 p.

Wilson D. McGraw-Hill Manual of Laboratory and Diagnostic Tests 1st Ed Normal, Illinois, 2007: 347-348 pp.

Гранулоциты низкой плотности: особый класс нейтрофилов при системном аутоиммунитете

Семин Иммунопатол. Авторская рукопись; Доступен в PMC 2014 Jul 1.

Опубликовано в окончательной редактированной форме AS:

PMCID: PMC4007274

NIHMSID: NIHMS463925

Carmelo Carmona-Rivera

1 Отдел ревматологии, отдел внутренней медицины, Университет Мичиган, Медицинская школа, Анн-Арбор, Мичиган, США

Мариана Дж.Kaplan

1 Отделение ревматологии, отделение внутренней медицины, Мичиганский университет, Медицинская школа, Анн-Арбор, Мичиган, США

1 Отделение ревматологии, отделение внутренней медицины, Мичиганский университет, Медицинская школа, Анн-Арбор, Мичиган, США

* Автор, ответственный за переписку: Мариана Дж. Каплан, доктор медицинских наук, отделение ревматологии, отделение внутренней медицины, Медицинская школа Мичиганского университета, 1150 W. Medical Center Drive, 5520 Medical Science Research Building-I, Ann Arbor, MI 48109-5680, тел.: 734-936-3257; Факс: 734-763-4151; удэ[email protected] См. другие статьи в PMC, в которых цитируется опубликованная статья.

Abstract

Недавние исследования возобновили интерес к потенциальной роли нейтрофилов в развитии системной красной волчанки (СКВ) и других аутоиммунных состояний. Описано отдельное подмножество провоспалительных гранулоцитов низкой плотности (ЛДГ), выделенных из фракций мононуклеарных клеток периферической крови пациентов с СКВ. Хотя происхождение и роль ЛДГ необходимо полностью охарактеризовать, имеются доказательства того, что эти клетки могут способствовать патогенезу волчанки и развитию поражения органов-мишеней за счет усиления провоспалительных реакций, изменения фагоцитарной способности, повышенной способности синтезировать интерфероны типа I и для уничтожения эндотелиальных клеток.Кроме того, эти клетки легко образуют нейтрофильные внеклеточные ловушки (NETs), явление, которое может способствовать экстернализации аутоантигена и повреждению органов. В этом обзоре рассматривается биология и потенциальное происхождение ЛДГ, описываются ультраструктурные характеристики этих клеток и обсуждается их предполагаемая патогенная роль в системных аутоиммунных заболеваниях.

Нейтрофилы и патогенез системной красной волчанки (СКВ).Нейтрофилы представляют собой короткоживущие немитотические клетки, которые продуцируют различные провоспалительные молекулы, важные для инициации и усиления воспалительных реакций; поэтому их развертывание строго контролируется, чтобы свести к минимуму повреждение органов [1]. Нейтрофилы созревают в костном мозге и попадают в кровоток после терминальной дифференцировки [2].

В то время как аберрантные реакции нейтрофилов были описаны при различных хронических воспалительных и аутоиммунных состояниях, роль, которую нейтрофилы играют при системной красной волчанке (СКВ), до недавнего времени была менее ясной.Классически СКВ описывают как системный аутоиммунный синдром, характеризующийся продукцией иммунных комплексов и аутоантител к различным ядерным антигенам [3]. Волчанка имеет хроническое течение, при котором субклинический аутоиммунитет предшествует развитию явных клинических проявлений, вторичных по отношению к иммуноопосредованному повреждению тканей [4]. Ускоренный атеросклероз также является характерным признаком СКВ и представляет собой частую причину заболеваемости и смертности [5]. СКВ обычно считается заболеванием аномального адаптивного иммунитета, при котором явно важную роль в патогенезе играют как В-, так и Т-лимфоциты [6, 7].Однако данные, полученные за последние несколько десятилетий, также явно указывают на аномальные врожденные иммунные реакции (особенно заметную роль интерферонов типа I (IFN)) в развитии аутоиммунитета и повреждении органов при этом заболевании [8-11]. Совсем недавно несколько групп предложили новую роль ответа нейтрофилов в развитии потери толерантности и повреждения органов при СКВ.

Волчаночные нейтрофилы имеют измененные функциональные свойства, включая снижение фагоцитарной способности, повышенную агрегацию и внутрисосудистую активацию [12-16].Кроме того, истощение нейтрофилов может защитить от опосредованного антителами гломерулонефрита, что подтверждает роль этих клеток в развитии аутоиммунных реакций и поражении органов при СКВ [17]. Однако в предыдущих исследованиях не проводилось систематического анализа подмножеств нейтрофилов в отношении различий в патогенности или функции.

Выделение и характеристика гранулоцитов низкой плотности (LDGs) при волчанке взрослых больных СКВ [18].Наличие этого подмножества с низкой плавучестью коррелирует с активностью заболевания, и эта группа предположила, что гуморальные факторы, присутствующие в плазме больных волчанкой, могут быть ответственны за этот фенотип [18]. В 2003 г. Беннетт и соавт. выполнили микрочиповый анализ мононуклеарных клеток крови, выделенных по градиенту плотности у детей, больных волчанкой, и выявили высокую экспрессию генов, специфичных для нейтрофилов. Они предположили, что эта сигнатура была результатом незрелых нейтрофилов, присутствующих во фракциях РВМС этих пациентов [10].За этими наблюдениями последовала публикация Nakou et al., которая продемонстрировала, что массивы генов, выполненные в костном мозге взрослых пациентов с СКВ, также выявили повышенную регуляцию генов, связанных с гранулопоэзом, связанных с активностью заболевания. Примечательно, что некоторые из генов с повышенной регуляцией были обнаружены на ранних стадиях развития нейтрофилов [19]. Мы разработали методику отрицательной селекции для высокой степени очистки этих нейтрофилов низкой плотности, которые мы назвали «гранулоцитами низкой плотности» или LDG, из фракций PBMC пациентов с волчанкой [9].Используя этот подход, мы подтвердили, что все исследованные взрослые пациенты с СКВ демонстрировали ЛДГ в их фракциях РВМС, причем у пациентов с более высоким количеством этих клеток на периферии развивалась повышенная распространенность поражения кожи и/или васкулит [9].

В LDG было выявлено несколько отличительных черт, которые далее обсуждаются в этом обзоре. По сравнению с контрольными нейтрофилами или аутологичными нейтрофилами волчанки нормальной плотности, ЛДГ демонстрируют повышенную способность синтезировать интерфероны типа I при определенных типах стимуляции (включая фактор стимуляции гранулоцитов-колоний (G-CSF) или полиинозиновую: полицитидиловую кислоту (поли-I:C). ).Кроме того, ЛДГ проявляют сниженную способность к фагоцитозу бактерий, но обладают поразительно повышенной способностью образовывать нейтрофильные внеклеточные ловушки (НЭТ) [9, 20]. NET характеризуются как хроматиновые волокна, связанные с гранулярными белками, которые высвобождаются во внеклеточное пространство для иммобилизации и уничтожения вторгшихся микробов во время процесса клеточной смерти, называемого «NETosis» [21, 22]. В дополнение к их антимикробной роли, последние данные свидетельствуют о том, что НЭО могут вызывать повреждение эндотелия и выявлять мощные иммуностимулирующие молекулы [20, 23].Из-за потенциальной роли сетчатых нейтрофилов в экстернализации аутоантигенов и активации адаптивной иммунной системы мы предположили, что ЛДГ, по крайней мере частично, за счет NET-ассоциированного эффекта, могут играть важную роль в патогенезе СКВ и связанного с ней повреждения органов. . Более подробно это рассматривается далее в этом обзоре.

Морфология и функция ЛДГ волчанки

Фенотипически нейтрофил можно отличить по двум отличительным морфологическим характеристикам: его уникальному полиморфному ядру и содержанию его гранул.Кроме того, классификация нейтрофилов и их предшественников основана на стадии их созревания в костном мозге. Миелопоэз представляет собой строго контролируемый процесс, посредством которого клетки-предшественники делятся и дифференцируются из плюрипотентных гемопоэтических стволовых клеток и превращаются в коммитированные стволовые клетки, дающие ограниченное по клону потомство. Во время созревания нейтрофилы приобретают продукты своих гранул, а вариации во времени синтеза различных белков, присутствующих в гранулах, приводят к образованию подмножеств гранул с различным содержанием пептидов в зависимости от конкретной стадии дифференцировки.Считается, что повышенная гетерогенность нейтрофильных гранул возникает в результате непрерывного образования гранул от миелобласта до сегментоядерных стадий. В нормальных условиях нейтрофилы высвобождаются из костного мозга при терминальной дифференцировке [24].

Стадия развития ЛДГ и механизмы, управляющие их синтезом при СКВ, остаются неясными. В то время как зрелые нейтрофилы обычно осаждаются вместе с фракцией эритроцитов в градиенте плотности фиколла, ЛДГ очищаются совместно с фракцией МКВК.Исследование ядерной морфологии ЛДГ методом дифференциального окрашивания выявило смешанную популяцию сегментоядерных, палочкоядерных или миелоцитоподобных клеток [9, 10]. Чтобы установить, является ли низкая плотность этих клеток результатом дегрануляции вследствие активации или результатом более незрелого фенотипа, мы провели трансмиссионную электронную микроскопию очищенных фракций ЛДГ волчанки и сравнили их ультраструктурные характеристики с характеристиками нормальной плотности. нейтрофилы. Используя этот подход, мы наблюдали, что LDG имеют менее сегментированные ядра по сравнению с гранулоцитами нормальной плотности, с четко очерченными гетеро- (плотными) и эухроматиновыми (деконденсированными) и с различными типами гранул, идентифицированными в их цитоплазме.Морфология ядра с помощью ультраструктурного анализа может указывать на более незрелую стадию, такую ​​как полосчатые/ювенильные формы. Эти наблюдения подтверждают мнение о том, что ЛДГ не представляют собой подмножество активированных нейтрофилов, подвергшихся высвобождению гранул. Кроме того, в цитоплазме ЛДГ отсутствуют признаки вакуолизации или апоптоза (11).

Анализ морфологии волчаночных гранулоцитов низкой плотности с помощью электронной микроскопии

Просвечивающая электронная микроскопия (ПЭМ) гранулоцитов нормальной плотности (AC) и гранулоцитов низкой плотности (DF), выделенных у пациента с СКВ, показывает различные типы гранул в их цитоплазме.В обеих клетках четко определяются гетерохроматиновые (темные) и эухроматиновые (более светлые) участки. Ядерные доли четко определяются в гранулоцитах нормальной плотности, в то время как ЛДГ демонстрируют менее дольчатые ядра.

Анализ массива генов ЛДГ

В качестве дополнительного инструмента для оценки того, представляют ли ЛДГ отдельный пул нейтрофилов, профилирование экспрессии генов очищенных фракций нейтрофилов ЛДГ волчанки, аутологичных нейтрофилов волчанки и контрольных нейтрофилов определяли с использованием микрочипов Affymetrix.Хотя при сравнении нейтрофилов волчанки нормальной плотности со здоровыми контрольными нейтрофилами ни один из генов не регулировался значительно по-разному, некоторые гены по-разному экспрессировались в LDG по сравнению с другими группами нейтрофилов. Действительно, 302 гена были по-разному экспрессированы в волчаночных ЛДГ по сравнению с контрольными нейтрофилами, а 281 ген был изменен при попарном сравнении ЛДГ каждого пациента с их аутологичными волчаночными нейтрофилами. Кроме того, 224 гена были активизированы в обоих сравнениях.Кроме того, 57 генов были избирательно отрегулированы в ЛДГ волчанки по сравнению с аутологичными волчаночными нейтрофилами, а 78 генов были ограничены только ЛДГ по сравнению с контрольными нейтрофилами. Идентификация канонических путей идентифицировала актиновый цитоскелет, макропиноцитоз, клатрин-опосредованный эндоцитоз и интегриновые сигнальные пути среди наиболее значительно регулируемых волчаночных ЛДГ по сравнению с нейтрофилами нормальной плотности. Интересно, что в волчаночных ЛДГ гены с максимальной активацией включали различные сериновые протеазы, бактерицидные белки и другие молекулы, присутствующие в азурофильных гранулах и участвующие в регуляции нейтрофильными воспалительными реакциями [20].Эти результаты еще раз указывают на более незрелый фенотип LDG, поскольку уровни экспрессии мРНК, которые кодируют сериновые протеазы нейтрофилов, максимальны на промиелоцитарной стадии дифференцировки нейтрофилов и снижаются по мере созревания нейтрофилов [25]. В поддержку анализа массива генов недавно сообщалось о высоких уровнях кальпротектина (S100A8/S100A9) в протеомном анализе РВМС при СКВ, что находится в прямой корреляции с наличием ЛДГ. Эти наблюдения предполагают протеомную сигнатуру циркулирующих ЛДГ у пациентов с волчанкой, что требует дальнейшего изучения [26].В целом, основываясь на профиле экспрессии генов и ультраструктурном анализе LDG, возможно, что они представляют собой более незрелую подгруппу гранулоцитов, преждевременно высвобождаемую из костного мозга из-за еще не охарактеризованных стимулов. Эти наблюдения согласуются с исследованиями Bennett et al. у детей с волчанкой, как упоминалось выше [10]. Различные цитокины, присутствующие в большом количестве при СКВ, потенциально могут усиливать мобилизацию предшественников нейтрофилов из костного мозга или нарушать их способность к дифференцировке.Среди предполагаемых стимулов следует рассматривать гранулоцитарно-макрофагальный колониестимулирующий фактор (ГМ-КСФ) и ИФН I типа, поскольку сообщается, что уровни этих цитокинов повышены при СКВ и могут стимулировать мобилизацию костного мозга и/или нарушать дифференцировку, соответственно [27, 28]. Однако, поскольку микрочиповый анализ LDG не выявил признаков повышенной экспрессии генов, индуцируемых IFN типа I [20, 29], не представляется, что LDG представляют собой подмножество, преимущественно подвергающееся воздействию более высоких уровней этих цитокинов.

Поверхностные маркеры ЛДГ и статус активации

Точная характеристика происхождения и статуса дифференцировки ЛДГ была проблематичной, отчасти из-за несоответствий, обнаруженных между исследованиями ядерной морфологии/экспрессии генов и характеристикой молекул клеточной поверхности. Действительно, в то время как исследования ядерной морфологии и экспрессии генов указывают на незрелый фенотип, анализ маркеров клеточной поверхности LDG с использованием проточной цитометрии (FACS) указывает на зрелые гранулоциты [9] ().LDG можно отличить от моноцитов с помощью FACS по их высокой экспрессии CD15 и низкой экспрессии CD14. Напротив, моноциты имеют высокий уровень CD14 и низкий уровень CD15 [9]. Что касается других маркеров, LDG экспрессируют CD10 и CD16, оба характерны для зрелых гранулоцитов. CD33, маркер, экспрессируемый на развивающихся или незрелых гранулоцитах, экспрессируется очень слабо, без обнаружения других ранних маркеров-предшественников, таких как CD34 и Flt-3. Кроме того, LDG экспрессируют CD31, CD11c, G-CSFR и GM-CSFR.По сравнению со здоровыми контрольными нейтрофилами, LDG и аутологичные нейтрофилы волчанки имеют активированный фенотип, основанный на экспрессии поверхностных молекул CD66b и CD11b, но они не различаются в отношении экспрессии и выделения L-селектина до и после экзогенной стимуляции [9]. Как согласовать анализ маркеров клеточной поверхности с анализом ядерной морфологии, остается неясным. Мы не можем исключить возможность того, что ЛДГ представляют собой гетерогенную популяцию нейтрофилов, состоящую не только из зрелых активированных или незрелых клеток.Чтобы иметь глубокое представление о природе LDG, необходимо провести более полный анализ, подтверждающий статус других гранулярных резидентных белков. Кроме того, эпигенетические маркеры гетерохроматина также могут быть использованы для оценки того, демонстрируют ли LDG неполное/аберрантное развитие и/или остановку [30, 31].

Таблица 1

Таблица 1

Фенотипические и функциональные характеристики нейтрофилов низкой плотности. CD10 + , CD11C Lo ,
CD14 Lo , CD15 HI
CD1615 + CD31 +
CD116 + , CD116 зрелый менее сегментированный гетерогенный
(Myeloid-like, группа) Менее фагоцитоз
Усиленная секреция цитокина
Улучшенный нетоз PSORIASIS CD10 + , CD14 LO ND ND Расширенный Netosis
Secrete IL-17 ВИЧ CD15 привет зрелые сегментированные 900 90 ND ND низкая активность аргиназы CD11B HI , CD13 HI ,
CD15 HI , CD16 Lo ,
CD24 HI , CD33 HI
CD62L LO , CD66B HI
VEGFR1Hi
VEGFR1HI ND гетерогенная популяция (миелоидный, сегментированный) подавить пролиферацию Т-клеток
и IFN γ-производства тяжелая инфекция CD10 зрелый GELANUTUT
со множеством вакуулов ND снижение химической активности

минимальная β-глюкуронидаза
активность


Противоплатный фенотип Lupus LDGS

в дополнение к выделению протеазы посредством дегрануляции и / или нетоз, нейтрофилов может синтезировать воспалительные цитокины и эйкозаноиды при рекрутировании в очаги инфекции [1].Активированные нейтрофилы обладают способностью синтезировать мРНК TNF-α [32], и мы сообщали, что ЛДГ секретируют более высокие уровни этого цитокина, чем нейтрофилы нормальной плотности [9]. Поскольку избыточная экспрессия TNF-α была задокументирована при волчаночном нефрите [33-35] и может играть важную роль в повреждении почек при этом заболевании [36], возможно, что эти клетки могут представлять собой один из источников этого цитокина в этом заболевании. болезнь. Уровни синтеза ИЛ-8 и ИЛ-6 также оказались выше у ЛДГ по сравнению с аутологичной волчанкой и контрольными нейтрофилами [9], что может способствовать усилению воспалительных реакций и повреждению тканей при СКВ.

Интерфероны I типа (IFN) секретируются нейтрофилами [37, 38] при определенных типах стимуляции. Как упоминалось выше, мы обнаружили, что ЛДГ обладают повышенной способностью синтезировать эти цитокины по сравнению со здоровыми контрольными нейтрофилами или с аутологичными нейтрофилами волчанки. Действительно, LDG синтезируют в культуре достаточное количество IFN типа I, чтобы препятствовать способности эндотелиальных клеток-предшественников дифференцироваться в зрелые эндотелиальные клетки [9], явление, связанное с развитием преждевременного атеросклероза, которое значительно влияет на пациентов с волчанкой [8, 39]. ].Напротив, истощение плазмацитоидных дендритных клеток, клеток, синтезирующих самые высокие концентрации IFN-α в системах человека и мыши, не влияло на дифференцировку эндотелиальных клеток. Это наблюдение предполагает, что ЛДГ могут играть заметную роль в нарушении здоровья эндотелия при СКВ, по крайней мере, частично за счет эффекта ИФН I типа. Пути, ведущие к усиленному синтезу IFN I типа с помощью LDG (TLR-зависимые и/или независимые), еще предстоит полностью охарактеризовать. Кроме того, еще предстоит определить специфические IFN типа I, которые синтезируются на более высоких уровнях LDG как на уровне мРНК, так и на уровне белка.

ЛДГ и НЭТоз

Помимо фагоцитоза и дегрануляции нейтрофилы обладают еще одним антимикробным механизмом иммобилизации и уничтожения вторгшихся патогенов, называемым НЭТозом [21]. При НЕТозе из нейтрофилов экструдируются большие нити ДНК, несущие специфические белки из цитозоля и гранул () [21, 40]. NET могут образовываться при активации PMA, бактериями, грибами, вирусами, микробными продуктами и активированными тромбоцитами и различными цитокинами [21, 29, 41-50]. Наша группа и другие сообщили, что нейтрофилы, выделенные от пациентов с СКВ, готовы к созданию сетей [20, 48, 49].В частности, LDG обладают поразительным улучшением своей способности генерировать сети [9, 20]. Были предложены различные стимулы для индукции усиленного НЕТоза при СКВ, включая иммунные комплексы, IFN I типа и аутоАТ ​​[20, 48, 49]. Важно отметить, что сетчатые нейтрофилы были предложены в качестве сильных индукторов синтеза IFN-α pDCs [20, 49], тем самым подтверждая дополнительный вклад в патогенез волчанки. Кроме того, IFN типа I могут потенцировать продукцию NETs зрелыми нейтрофилами [46], и это может привести к самовоспроизводящемуся циклу, когда цитокины активируют гранулоциты, чтобы умереть от NETosis, что, в свою очередь, приводит к большему синтезу IFN I типа pDCs.Кроме того, сыворотка пациентов с СКВ может связываться с НЭО (2), что позволяет предположить, что при этом заболевании образуются аутоантитела к компонентам НЭО. Кроме того, NET, генерируемые LDG, обладают способностью стимулировать воспалительный механизм NLRP3 на повышенных уровнях в макрофагах волчанки с потенциалом установления порочных воспалительных циклов [50].

Обнаружение зернистых белков нейтрофилов в НЭО

Иммунофлуоресцентные микрофотографии контрольных нейтрофилов, активированных LPS in vitro , высвобождающих НЭО, характеризующихся как длинные нити ДНК (синие), украшенные противомикробным пептидом LL-37 (зеленые) и нейтрофильной эластазой (красный).Оригинальное увеличение 40×.

Аутоантитела, присутствующие при СКВ, но не в контрольной сыворотке, реагируют с молекулами, присутствующими в LDG NET

NET, образованные LPS-стимуляцией контрольных нейтрофилов или спонтанно высвобождаемые при волчанке LDG, инкубировали с 10% здоровой контрольной сывороткой (верхняя панель) или 10 % сыворотки при СКВ (нижняя панель). Связанные IgG обнаруживали с помощью вторичного антитела, конъюгированного с красным флуорохромом. Синий представляет собой ядерный материал, согласно количественной оценке Hoechst. Оригинальное увеличение 40×.

Кроме того, Хакким и его коллеги продемонстрировали, что примерно одна треть образцов сыворотки, полученных от когорты больных СКВ, имеет нарушенную способность разрушать НЭО. Они имеют вовлеченные молекулы, присутствующие в сыворотке крови при СКВ, которые препятствуют активности ДНКазы I. Они выявили связь между больными СКВ со слабой активностью ДНКазы I и высокими титрами антител к дцДНК, в то время как нарушение клиренса НЭО было связано с наличием нефрита [51]. Нарушение активности ДНКазы I у больных СКВ может быть обусловлено генетическими факторами [52, 53] или наличием в сыворотке крови ингибиторов ДНКазы I [51, 54].

Нарушение регуляции клиренса NET может играть роль в патогенезе волчанки, а также влиять на образование тромбоза у пациентов с СКВ [22]. Таким образом, присутствие LDG, обладающих повышенными возможностями связывания, в сочетании с нарушениями клиренса NET может привести к длительному воздействию антигенного материала и дальнейшей индукции провоспалительных цитокинов, которые могут увековечить порочный круг, ведущий к длительному аутоиммунитету у предрасположенных лиц.

Остается определить, играет ли экстернализация белков посредством образования NET заметную роль в потере толерантности к себе, активации адаптивных иммунных реакций и развитии аутоиммунитета.В то время как в недавнем исследовании очищенные сети не смогли усугубить аутоиммунный фенотип в некоторых мышиных моделях волчанки [55], необходимо рассмотреть роль вторичных сигналов или дополнительных стимулов, чтобы более четко определить, как сети могут способствовать аберрантным иммунным ответам. Также неясно, отличается ли белковый груз LDG NET от груза, вызываемого другими стимулами, индуцирующими NET.

ЛДГ и развитие поражения органов при СКВ

ЛДГ были связаны с повреждением эндотелия, а также с индукцией аномальной эндотелиальной дифференцировки с потенциальными последствиями в развитии преждевременного атеросклероза, поражающего пациентов с различными аутоиммунными заболеваниями [9]. 20]. Эксперименты in vitro, проведенные в нашей лаборатории, демонстрируют восстановление способности эндотелиальных предшественников дифференцироваться в зрелый эндотелий при истощении ЛДГ из культур [9]. Кроме того, цитотоксический эффект LDG на эндотелиальные клетки, по-видимому, связан с их способностью синтезировать NET, поскольку наблюдалось прекращение гибели сосудистых клеток в присутствии нуклеазы, разрушающей NET [20]. Механизмы, с помощью которых NETs повреждают эндотелий, еще предстоит полностью определить, хотя гистоны, присутствующие в этих структурах, могут играть видную роль [56].

Точная роль, которую ЛДГ могут играть в других осложнениях волчанки, включая нефрит и кожные заболевания, еще предстоит определить. Как упоминалось выше, более высокое количество LDG коррелировало с поражением кожи и васкулитом в наших первоначальных наблюдениях [9]. Кроме того, наблюдались сетчатые нейтрофилы, инфильтрирующие кожу и почки у пациентов с волчанкой с дерматологическими и почечными осложнениями [20]. Однако остается неясным, представляют ли эти клетки LDG или нейтрофилы нормальной плотности, поскольку не было идентифицировано никаких отличительных клеточных маркеров, которые могли бы различать эти два типа нейтрофилов на тканевом уровне.

ЛДГ при других заболеваниях

Нейтрофилы с признаками низкой плотности были зарегистрированы при таких состояниях, как рак, ВИЧ-инфекция, сепсис, псориаз и, недавно, в модели крысиного артрита, индуцированного пристаном (ПИА) [57-61]. С другой стороны, неясно, представляют ли эти клетки отдельный фенотип (как описано при СКВ) или просто дегранулированные клетки. Например, у пациентов с сепсисом наблюдается повышенное количество нейтрофилов низкой плотности со сниженной хемотаксической реакцией и минимальной активностью β-глюкуронидазы.Однако морфология и анализ клеточной поверхности этих клеток показывают, что они представляют собой зрелые дегранулированные нейтрофилы с вакуолизированной цитоплазмой [57].

LDG были обнаружены и у других позвоночных. Разделение в градиенте плотности крови от свиней, инфицированных вирусом классического свиного гриппа (КЧС), показывает наличие SWC3-позитивных гранулоцитов, панмиелоидного маркера, в их препарате РВМС [62]. Морфологический анализ показал, что SSC+ SWC+ представляли собой незрелые гранулоциты, в основном миелоциты и палочкоядерные нейтрофилы [62].

Как упоминалось выше, мы задокументировали ЛДГ в периферической крови больных псориазом [60]. Подобно СКВ, мы обнаружили, что ЛДГ псориаза более склонны к образованию сетей, которые экстернализируют ИЛ-17, провоспалительный цитокин, связанный с патогенезом псориаза и других аутоиммунных заболеваний, таких как ревматоидный артрит (РА) [63]. Нейтрофилы с низкой плавучестью также первоначально были описаны при ревматоидном артрите [18], а недавно модель крыс с индуцированным пристаном артритом продемонстрировала повышенный процент клеток, экспрессирующих His 48+, крысиный маркер гранулоцитов, совместно очищающихся с РВМС [61].Экспрессия rCRAMP, крысиного аналога кателицидина LL-37, была выше при ПИА по сравнению с крысами, не получавшими лечения. Такая экспрессия была в основном выражена в клетках His48 +, что подтверждает присутствие гранулоцитов. Хотя происхождение этих гранулоцитов неизвестно, авторы предположили их раннее высвобождение из костного мозга за счет ускоренного оборота зрелых нейтрофилов. Насколько нам известно, это первое сообщение о предполагаемом подмножестве LDG в модели аутоиммунитета на животных. Можно ли найти подобные клетки в мышиных моделях волчанки, еще предстоит определить.

ВЫВОДЫ

Как упоминалось выше, возможно, что цитокины, аутоАТ ​​и/или иммунные комплексы, присутствующие у больных волчанкой, могут изменять нишу костного мозга или способствовать высвобождению незрелых гранулоцитов (). Однако неясно, может ли воздействие цитокинов и/или иммунных комплексов на гранулоциты костного мозга изменить их морфологию и/или экспрессию генов. И наоборот, и учитывая профиль маркеров клеточной поверхности, соответствующий зрелым клеткам, LDG могут представлять собой субпопуляцию активированных нейтрофилов, подобных тем, которые обнаружены в маргинальной зоне селезенки у людей [64].В этом случае было обнаружено, что нейтрофилы селезенки имеют отличный фенотип по сравнению с циркулирующими нейтрофилами и вызывают специфический адаптивный иммунитет в В-клетках маргинальной зоны через NET-подобные структуры [64]. Это открытие поддерживает представление о том, что подмножества нейтрофилов, присутствующих в разных тканях, могут иметь различные фенотипы и функции, и что это необходимо дополнительно оценить в случае ЛДГ. Исследования на животных моделях аутоиммунитета необходимы для дальнейшего выяснения происхождения, статуса созревания и патогенности ЛДГ.Это также дало бы нам возможность протестировать потенциальные фармакологические подходы в этой конкретной подгруппе клеток. Будущая характеристика и установление специфических маркеров ЛДГ может оказаться очень полезным для оценки их предполагаемой роли в повреждении тканей при волчанке и других заболеваниях.

Схематическое изображение возможного происхождения ЛДГ при СКВ. ядерная морфология. (2) Альтернативно, зрелые нейтрофилы, подвергшиеся воздействию высоких уровней вышеупомянутых молекул, изменяют экспрессию своих генов, способность к самонаведению и фенотип, создавая аберрантную патогенную субпопуляцию.

Тем не менее, результаты, обобщенные в этом обзоре, подтверждают существование отдельной подгруппы аберрантных нейтрофилов у пациентов с СКВ. Необходимы лонгитюдные исследования для систематической оценки того, можно ли использовать ЛДГ в качестве биомаркеров или предикторов повреждения тканей, активности заболевания и специфических осложнений при СКВ.Кроме того, важно выяснить, играют ли ПЯЛ с низкой плавучестью, обнаруженные при других аутоиммунных заболеваниях, такие же патогенные роли, как и при СКВ, в отношении синтеза цитокинов, способности генерировать НЭО и т. д.

Факторы, определяющие аномальный фенотип и функцию волчанки Необходимо определить ЛДГ, и они могут включать специфические цитокины, которые могут остановить созревание нейтрофилов. Неясно, обладают ли NET, генерируемые LDG, отличными иммуностимулирующими способностями и белковым грузом от тех, которые генерируются обычными нейтрофилами в ответ на микробы.Наконец, взаимодействие между LDGs и адаптивной иммунной системой должно быть в центре внимания будущих исследований. Выяснив происхождение и патогенность ЛДГ, мы сможем разработать новые терапевтические стратегии при волчанке и других аутоиммунных заболеваниях. Возможно, мы также сможем лучше понять связь между инфекциями и развитием аутоиммунных реакций и вспышек заболевания.

Благодарности

При поддержке NIH через гранты PHS AR007080 и HL088419.

Каталожные номера

1.Weiss SJ, Young J, LoBuglio AF, Slivka A, Nimeh NF. Роль перекиси водорода в нейтрофильной деструкции культивируемых эндотелиальных клеток. Джей Клин Инвест. 1981; 68: 714–721. [Бесплатная статья PMC] [PubMed] [Google Scholar]2. Бейнтон Д.Ф., Уллиот Дж.Л., Фаркуар М.Г. Развитие нейтрофильных полиморфноядерных лейкоцитов в костном мозге человека. J Эксперт Мед. 1971; 134: 907–934. [Бесплатная статья PMC] [PubMed] [Google Scholar]3. Киттарис В.К., Хуанг Ю.Т., Цокос Г.К. Иммунные клетки и цитокины при системной красной волчанке: обновленная информация.Курр Опин Ревматол. 2005; 17: 518–522. [PubMed] [Google Scholar]4. Camussi G, Cappio FC, Messina M, Coppo R, Stratta P, Vercellone A. Иммуногистологический метод полиморфноядерных нейтрофилов (PMN): обнаружение иммунных комплексов, связанных с мембраной PMN, при остром постстрептококковом и волчаночном нефрите. Клин Нефрол. 1980; 14: 280–287. [PubMed] [Google Scholar]5. Уорд ММ. Преждевременная заболеваемость сердечно-сосудистыми и цереброваскулярными заболеваниями у женщин с системной красной волчанкой. Ревмирующий артрит.1999; 42: 338–346. [PubMed] [Google Scholar]7. Дорнер Т., Якоби А.М., Ли Дж., Липски П.Е. Аномалии субпопуляций В-клеток у пациентов с системной красной волчанкой. Дж Иммунол Методы. 2011; 363:187–197. [PubMed] [Google Scholar]8. Денни М.Ф., Чандарой П., Киллен П.Д., Кариккио Р., Льюис Э.Э., Ричардсон Б.К., Ли К.Д., Гавальчин Дж., Каплан М.Дж. Ускоренный апоптоз макрофагов вызывает образование аутоантител и повреждение органов при системной красной волчанке. Дж Иммунол. 2006;176:2095–2104. [PubMed] [Google Scholar]9.Денни М.Ф., Ялаварти С., Чжао В., Такер С.Г., Андерсон М., Сэнди А.Р., МакКьюн В.Дж., Каплан М.Дж. Отдельная подгруппа провоспалительных нейтрофилов, выделенных у пациентов с системной красной волчанкой, вызывает повреждение сосудов и синтезирует интерфероны I типа. Дж Иммунол. 2010;184:3284–3297. [Бесплатная статья PMC] [PubMed] [Google Scholar]10. Bennett L, Palucka AK, Arce E, Cantrell V, Borvak J, Banchereau J, Pascual V. Сигнатуры интерферона и гранулопоэза в крови при системной красной волчанке. J Эксперт Мед. 2003; 197: 711–723.[Бесплатная статья PMC] [PubMed] [Google Scholar]11. Banchereau J, Pascual V. Интерферон I типа при системной красной волчанке и других аутоиммунных заболеваниях. Иммунитет. 2006; 25: 383–392. [PubMed] [Google Scholar] 12. Брандт Л., Хедберг Х. Нарушение фагоцитоза гранулоцитами периферической крови при системной красной волчанке. Scand J Haematol. 1969; 6: 348–353. [PubMed] [Google Scholar] 13. Кортни П.А., Крокард А.Д., Уильямсон К., Ирвин А.Е., Кеннеди Р.Дж., Белл А.Л. Повышенный апоптоз нейтрофилов периферической крови при системной красной волчанке: связь с активностью заболевания, наличием антител к двухцепочечной ДНК и нейтропенией.Энн Реум Дис. 1999; 58: 309–314. [Бесплатная статья PMC] [PubMed] [Google Scholar]14. Хашимото Ю., Зифф М., Херд Э.Р. Повышенная адгезия эндотелиальных клеток, агрегация и образование супероксида нейтрофилами, инкубированными в сыворотке при системной красной волчанке и синдроме Фелти. Ревмирующий артрит. 1982; 25: 1409–1418. [PubMed] [Google Scholar] 15. Абрамсон С.Б., Гивен В.П., Эдельсон Х.С., Вайсманн Г. Агрегация нейтрофилов, индуцированная сывороткой пациентов с активной системной красной волчанкой. Ревмирующий артрит. 1983; 26: 630–636.[PubMed] [Google Scholar] 16. Молад Ю., Буйон Дж., Андерсон Д.С., Абрамсон С.Б., Кронштейн Б.Н. Внутрисосудистая активация нейтрофилов при системной красной волчанке (СКВ): диссоциация между повышенной экспрессией CD11b/CD18 и сниженной экспрессией L-селектина на нейтрофилах у пациентов с активной СКВ. Клин Иммунол Иммунопатол. 1994; 71: 281–286. [PubMed] [Google Scholar] 17. Cochrane CG, Unanue ER, Dixon FJ. Роль полиморфноядерных лейкоцитов и комплемента при нефротоксическом нефрите. J Эксперт Мед.1965; 122: 99–116. [Бесплатная статья PMC] [PubMed] [Google Scholar]18. Hacbarth E, Kajdacsy-Balla A. Нейтрофилы низкой плотности у пациентов с системной красной волчанкой, ревматоидным артритом и острой ревматической лихорадкой. Ревмирующий артрит. 1986; 29: 1334–1342. [PubMed] [Google Scholar] 19. Наку М., Ноултон Н., Франк М.Б., Берциас Г., Осбан Дж., Сандел К.Э., Пападаки Х., Раптопулу А., Сидиропулос П., Критикос И. и др. Экспрессия генов при системной красной волчанке: анализ костного мозга отличает активное заболевание от неактивного и выявляет признаки апоптоза и гранулопоэза.Ревмирующий артрит. 2008; 58:3541–3549. [Бесплатная статья PMC] [PubMed] [Google Scholar]20. Вильянуэва Э., Ялаварти С., Бертье С.С., Ходгин Дж.Б., Кхандпур Р., Лин А.М., Рубин С.Дж., Чжао В., Олсен С.Х., Клинкер М. и др. Сетчатые нейтрофилы индуцируют повреждение эндотелия, инфильтрируют ткани и высвобождают иммуностимулирующие молекулы при системной красной волчанке. Дж Иммунол. 2011; 187: 538–552. [Бесплатная статья PMC] [PubMed] [Google Scholar]21. Бринкманн В., Райхард Ю., Гусманн С., Фаулер Б., Улеманн Ю., Вайс Д.С., Вайнраух Ю., Зыхлинский А.Нейтрофильные внеклеточные ловушки убивают бактерии. Наука. 2004; 303:1532–1535. [PubMed] [Google Scholar] 22. Fuchs TA, Abed U, Goosmann C, Hurwitz R, Schulze I, Wahn V, Weinrauch Y, Brinkmann V, Zychlinsky A. Новая программа гибели клеток приводит к нейтрофильным внеклеточным ловушкам. Джей Селл Биол. 2007; 176: 231–241. [Бесплатная статья PMC] [PubMed] [Google Scholar]23. Саффарзаде М., Юенеманн С., Квайссер М.А., Лохнит Г., Баррето Г., Галуска С.П., Ломейер Дж., Прейснер К.Т. Нейтрофильные внеклеточные ловушки непосредственно вызывают гибель эпителиальных и эндотелиальных клеток: преобладающая роль гистонов.ПЛОС Один. 2012;7:e32366. [Бесплатная статья PMC] [PubMed] [Google Scholar]24. Моллинедо Ф., Боррегаард Н., Боксер Л.А. Новые тенденции в структуре, функции и развитии нейтрофилов. Иммунол сегодня. 1999; 20: 535–537. [PubMed] [Google Scholar] 25. Cowland JB, Borregaard N. Индивидуальная регуляция уровней мРНК белка гранул во время созревания нейтрофилов объясняет гетерогенность гранул нейтрофилов. Дж. Лейкок Биол. 1999;66:989–995. [PubMed] [Google Scholar] 26. Павон Э.Дж., Гарсия-Родригес С., Сумакеро Э., Перандрес-Лопес Р., Розаль-Вела А., Ларио А., Лонгобардо В., Карраскал М., Абиан Дж., Кальехас-Рубио Дж.Л. и др.Повышенная экспрессия и фосфорилирование двух изоформ S100A9 в мононуклеарных клетках пациентов с системной красной волчанкой: протеомный признак циркулирующих гранулоцитов низкой плотности. J Протеомика. 2012; 75: 1778–1791. [PubMed] [Google Scholar] 27. Fiehn C, Wermann M, Pezzutto A, Hufner M, Heilig B. [Концентрация GM-CSF в плазме при ревматоидном артрите, системной красной волчанке и спондилоартропатии] Z Rheumatol. 1992; 51: 121–126. [PubMed] [Google Scholar] 28. Виллеке П., Шлютер Б., Шотте Х., Эррен М., Микхольц Э., Домшке В., Гаубиц М.Повышенная частота GM-CSF, секретирующих РВМС, у пациентов с активной системной красной волчанкой может быть снижена с помощью иммуноадсорбции. волчанка. 2004; 13: 257–262. [PubMed] [Google Scholar] 29. Рамос-Кичик В., Мондрагон-Флорес Р., Мондрагон-Кастелан М., Гонсалес-Позос С., Мунис-Эрнандес С., Рохас-Эспиноса О., Чакон-Салинас Р., Эстрада-Парра С., Эстрада-Гарсия И. Нейтрофильные внеклеточные ловушки индуцируются от микобактерий туберкулеза. Туберкулез (Эдинб) 2009; 89: 29–37. [PubMed] [Google Scholar] 30. Попова Е.Ю., Клакстон Д.Ф., Лукасова Е., Бёрд П.И., Григорьев С.А.Эпигенетические маркеры гетерохроматина отличают терминально дифференцированные лейкоциты от неполностью дифференцированных лейкозных клеток в крови человека. эксп Гематол. 2006; 34: 453–462. [PubMed] [Google Scholar] 31. Лукасова Е., Користек З., Фальк М., Козубек С., Григорьев С., Козубек М., Ондрей В., Крупова И. Метилирование гистонов при миелоидных лейкозах как потенциальный маркер гранулоцитарных аномалий. Дж. Лейкок Биол. 2005; 77: 100–111. [PubMed] [Google Scholar] 32. Линдеманн А., Ридель Д., Остер В., Циглер-Хайтброк Х.В., Мертельсманн Р., Херрманн Ф.Гранулоцитарно-макрофагальный колониестимулирующий фактор индуцирует секрецию цитокинов полиморфноядерными лейкоцитами человека. Джей Клин Инвест. 1989; 83: 1308–1312. [Бесплатная статья PMC] [PubMed] [Google Scholar]Retracted33. Студницка-Бенке А., Штайнер Г., Петера П., Смолен Ю.С. Фактор некроза опухоли альфа и его растворимые рецепторы параллельны клиническому заболеванию и аутоиммунной активности при системной красной волчанке. Br J Ревматол. 1996; 35: 1067–1074. [PubMed] [Google Scholar] 34. Габай С., Чакир Н., Морал Ф., Ру-Ломбард П., Мейер О., Дайер Дж. М., Вишер Т., Язычи Х., Герн П.А.Циркулирующие уровни растворимых рецепторов фактора некроза опухоли при системной красной волчанке значительно выше, чем при других ревматических заболеваниях, и коррелируют с активностью заболевания. J Ревматол. 1997; 24:303–308. [PubMed] [Google Scholar] 35. Малид Д., Руссо П., Бендаян М. Наличие фактора некроза опухоли альфа и интерлейкина-6 в мезангиальных клетках почек у пациентов с волчаночным нефритом. Хум Патол. 1995; 26: 558–564. [PubMed] [Google Scholar] 36. Эдвардс С.К., 3-й, Чжоу Т., Чжан Дж., Бейкер Т.Дж., Де М., Лонг Р.Э., Борчердинг Д.Р., Боулин Т.Л., Блютманн Х., Маунтц Д.Д.Ингибирование индуцированной суперантигеном продукции провоспалительных цитокинов и воспалительного артрита у мышей MRL-lpr/lpr с помощью ингибитора транскрипции TNF-альфа. Дж Иммунол. 1996; 157: 1758–1772. [PubMed] [Google Scholar] 37. Shirafuji N, Matsuda S, Ogura H, Tani K, Kodo H, Ozawa K, Nagata S, Asano S, Takaku F. Гранулоцитарный колониестимулирующий фактор стимулирует зрелые нейтрофильные гранулоциты человека к выработке интерферона-альфа. Кровь. 1990; 75:17–19. [PubMed] [Google Scholar] 38. Тамассия Н., Ле Муань В., Россато М., Донини М., Маккартни С., Кальцетти Ф., Колонна М., Баццони Ф., Кассателла М.А.Активация программы экспрессии иммунорегуляторных и противовирусных генов в поли(I:C)-трансфицированных нейтрофилах человека. Дж Иммунол. 2008; 181:6563–6573. [PubMed] [Google Scholar]40. Urban CF, Ermert D, Schmid M, Abu-Abed U, Goosmann C, Nacken W, Brinkmann V, Jungblut PR, Zychlinsky A. Нейтрофильные внеклеточные ловушки содержат кальпротектин, цитозольный белковый комплекс, участвующий в защите хозяина от Candida albicans. PLoS Патог. 2009;5:e1000639. [Бесплатная статья PMC] [PubMed] [Google Scholar]41. Urban CF, Reichard U, Brinkmann V, Zychlinsky A.Нейтрофильные внеклеточные ловушки захватывают и уничтожают дрожжевые и гифальные формы Candida albicans. Клеточная микробиология. 2006; 8: 668–676. [PubMed] [Google Scholar]42. Коген А.Л., Ямасаки К., Муто Дж., Санчес К.М., Кротти Александр Л., Таниос Дж., Лай И., Ким Дж.Е., Низет В., Галло Р.Л. Антимикробный дельта-токсин Staphylococcus epidermidis (фенолорастворимый модуль-гамма) взаимодействует с антимикробными пептидами хозяина для уничтожения стрептококка группы А. ПЛОС Один. 2010;5:e8557. [Бесплатная статья PMC] [PubMed] [Google Scholar]43. Clark SR, Ma AC, Tavener SA, McDonald B, Goodarzi Z, Kelly MM, Patel KD, Chakrabarti S, McAvoy E, Sinclair GD, et al.TLR4 тромбоцитов активирует внеклеточные ловушки нейтрофилов, чтобы заманить бактерии в септическую кровь. Нат Мед. 2007; 13:463, 469. [PubMed] [Google Scholar]44. Джуно Р.А., Панг Б., Веймер К.Е., Армбрустер К.Е., Мечи В.Е. Нетипируемая гемофильная палочка инициирует образование нейтрофильных внеклеточных ловушек. Заразить иммун. 2011; 79: 431–438. [Бесплатная статья PMC] [PubMed] [Google Scholar]45. Pilsczek FH, Salina D, Poon KK, Fahey C, Yipp BG, Sibley CD, Robbins SM, Green FH, Surette MG, Sugai M, et al. Новый механизм быстрого образования внеклеточной ловушки ядерных нейтрофилов в ответ на золотистый стафилококк.Дж Иммунол. 2010; 185:7413–7425. [PubMed] [Google Scholar]46. Мартинелли С., Уросевич М., Дарьядель А., Оберхольцер П.А., Бауманн С., Фей М.Ф., Даммер Р., Саймон Х.У., Юсефи С. Индукция генов, опосредующих формирование интерферон-зависимой внеклеточной ловушки во время дифференцировки нейтрофилов. Дж. Биол. Хим. 2004; 279:44123–44132. [PubMed] [Google Scholar]47. Гупта А.К., Хаслер П., Хольцгрев В., Гебхардт С., Хан С. Индукция решеток внеклеточной ДНК нейтрофилов плацентарными микрочастицами и ИЛ-8 и их присутствие при преэклампсии.Хум Иммунол. 2005;66:1146–1154. [PubMed] [Google Scholar]48. Гарсия-Ромо Г.С., Кайелли С., Вега Б., Коннолли Дж., Аллантаз Ф., Сюй З., Пунаро М., Байш Дж., Гвидуччи С., Коффман Р.Л. и др. Сетчатые нейтрофилы являются основными индукторами продукции IFN I типа при системной красной волчанке у детей. Sci Transl Med. 2011;3:73ra20. [Бесплатная статья PMC] [PubMed] [Google Scholar]49. Ланде Р., Гангули Д., Факкинетти В., Фраска Л., Конрад С., Грегорио Дж., Меллер С., Чамилос Г., Себасигари Р., Риччиери В. и др. Нейтрофилы активируют плазмоцитоидные дендритные клетки, высвобождая комплексы собственная ДНК-пептид при системной красной волчанке.Sci Transl Med. 2011;3:73ra19. [Бесплатная статья PMC] [PubMed] [Google Scholar]50. Каленберг Дж.М., Кармона-Ривера С., Смит С.К., Каплан М.Дж. Нейтрофильная внеклеточная ловушка, связанная с активацией белка воспаления NLRP3, усиливается в макрофагах волчанки. Дж Иммунол. 2012 [бесплатная статья PMC] [PubMed] [Google Scholar]51. Hakkim A, Furnrohr BG, Amann K, Laube B, Abed UA, Brinkmann V, Herrmann M, Voll RE, Zychlinsky A. Нарушение деградации внеклеточной ловушки нейтрофилов связано с волчаночным нефритом.Proc Natl Acad Sci U S A. 2010;107:9813–9818. [Бесплатная статья PMC] [PubMed] [Google Scholar]52. Ясутомо К., Хориучи Т., Кагами С., Цукамото Х., Хашимура С., Урушихара М., Курода Ю. Мутация ДНКSE1 у людей с системной красной волчанкой. Нат Жене. 2001; 28: 313–314. [PubMed] [Google Scholar]53. Shin HD, Park BL, Kim LH, Lee HS, Kim TY, Bae SC. Распространенный полиморфизм ДНКазы I, связанный с продукцией аутоантител у пациентов с системной красной волчанкой. Хум Мол Жене. 2004; 13: 2343–2350. [PubMed] [Google Scholar]54.Леффлер Дж., Мартин М., Гуллстранд Б., Тайден Х., Луд С., Трюдссон Л., Бенгтссон А.А., Блом А.М. Нейтрофильные внеклеточные ловушки, которые не деградируют при системной красной волчанке, активируют комплемент, усугубляя заболевание. Дж Иммунол. 2012;188:3522–3531. [PubMed] [Google Scholar]55. Лю С.Л., Тангсомбатвизит С., Розенберг Дж.М., Мандельбаум Г., Гиллеспи Е.К., Гозани О.П., Ализаде А.А., Утц П.Дж. Специфические посттрансляционные модификации гистонов нейтрофильных внеклеточных ловушек как иммуногены и потенциальные мишени волчаночных аутоантител.Артрит Res Ther. 2012;14:R25. [Бесплатная статья PMC] [PubMed] [Google Scholar]56. Кодрилье А., Кессенброк К., Гиллисс Б.М., Нгуен Д.С., Маркес М.Б., Монестье М., Той П., Верб З., Луни М.Р. Тромбоциты индуцируют нейтрофильные внеклеточные ловушки при остром повреждении легких, связанном с переливанием крови. Джей Клин Инвест. 2012;122:2661–2671. [Бесплатная статья PMC] [PubMed] [Google Scholar]57. Morisaki T, Goya T, Ishimitsu T, Torisu M. Увеличение субпопуляций с низкой плотностью и CD10 (CALLA) отрицательных нейтрофилов у тяжело инфицированных пациентов.Серж сегодня. 1992; 22: 322–327. [PubMed] [Google Scholar]58. Родригес П.С., Эрнстофф М.С., Эрнандес С., Аткинс М., Забалета Дж., Сьерра Р., Очоа АС. Миелоидные супрессорные клетки, продуцирующие аргиназу I, при почечно-клеточном раке представляют собой субпопуляцию активированных гранулоцитов. Рак Рез. 2009; 69: 1553–1560. [Бесплатная статья PMC] [PubMed] [Google Scholar]59. Клоук Т., Мундер М., Тейлор Г., Мюллер И., Кропф П. Характеристика новой популяции гранулоцитов низкой плотности, связанных с тяжестью заболевания при ВИЧ-1-инфекции.ПЛОС Один. 2012;7:e48939. [Бесплатная статья PMC] [PubMed] [Google Scholar]60. Лин А.М., Рубин С.Дж., Кхандпур Р., Ван Д.Ю., Риблетт М., Ялаварти С., Вильянуэва Э.С., Шах П., Каплан М.Дж., Брюс А.Т. Тучные клетки и нейтрофилы высвобождают IL-17 посредством образования внеклеточных ловушек при псориазе. Дж Иммунол. 2011; 187: 490–500. [Бесплатная статья PMC] [PubMed] [Google Scholar]61. Hoffmann MH, Bruns H, Backdahl L, Neregard P, Niederreiter B, Herrmann M, Catrina AI, Agerberth B, Holmdahl R. Кателицидины LL-37 и rCRAMP связаны с патогенными явлениями артрита у людей и крыс.Энн Реум Дис. 2012 [PubMed] [Google Scholar]62. Porntrakulpipat S, Depner KR, Moennig V. Являются ли гранулоциты низкой плотности основными клетками-мишенями вируса классической чумы свиней в периферической крови? J Vet Med B Infect Dis Vet Public Health. 2001; 48: 593–602. [PubMed] [Google Scholar]63. Уилсон Н.Дж., Бонифаций К., Чан Дж.Р., Маккензи Б.С., Блуменшайн В.М., Мэттсон Д.Д., Башам Б., Смит К., Чен Т., Морел Ф. и другие. Развитие, цитокиновый профиль и функция человеческих Т-хелперных клеток, продуцирующих интерлейкин 17. Нат Иммунол.2007; 8: 950–957. [PubMed] [Google Scholar]64. Puga I, Cols M, Barra CM, He B, Cassis L, Gentile M, Comerma L, Chorny A, Shan M, Xu W и др. В-клетки-хелперы нейтрофилы стимулируют диверсификацию и продукцию иммуноглобулина в маргинальной зоне селезенки. Нат Иммунол. 2012;13:170–180. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Гранулоциты низкой плотности активируют Т-клетки и демонстрируют несупрессивную роль при системной красной волчанке

Ann Rheum Dis. 2019 июль; 78(7): 957–966.

, 1 , 1 , 1 , 2 , 2 , 2 , 3 , 3 , 4 , 1 , 1 , 2 и 1

Сайфур Рахман

1 Департамент респираторных заболеваний, воспалений и аутоиммунитета, MedImmune LLC, Гейтерсберг, Мэриленд, США,

Дивья Сагар

1 Департамент респираторных заболеваний, воспалений и аутоиммунитета, MedImmune LLC, Гейтерсберг, Мэриленд, США,

Ричард Н. Ханна

1 Департамент респираторных заболеваний, воспалений и аутоиммунитета, MedImmune LLC, Гейтерсберг, Мэриленд, США,

Яйма Л Лайтфут

2 Отделение системных аутоиммунных заболеваний, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здоровья, Бетесда, Мэриленд, США,

Прагнеш Мистри

2 Отделение системных аутоиммунных заболеваний, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здоровья, Бетесда, Мэриленд, США,

Кэролайн К. Смит

2 Отделение системных аутоиммунных заболеваний, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здравоохранения, Бетесда, Мэриленд, США,

Зерай Манна

3 Программа клинических исследований волчанки, Офис клинического директора, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальные институты здравоохранения, Бетесда, Мэриленд, США,

Сарфараз Хасни

3 Программа клинических исследований волчанки, Офис клинического директора, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальные институты здравоохранения, Бетесда, Мэриленд, США,

Ричард М. Сигел

4 Секция иммунорегуляции, Отделение аутоиммунитета, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здравоохранения, Бетесда, Мэриленд, США,

Мигель А. Санхуан

1 Департамент респираторных заболеваний, воспалений и аутоиммунитета, MedImmune LLC, Гейтерсберг, Мэриленд, США,

Роланд Колбек

1 Департамент респираторных заболеваний, воспалений и аутоиммунитета, MedImmune LLC, Гейтерсберг, Мэриленд, США,

Мариана Дж. Каплан

2 Отделение системных аутоиммунных заболеваний, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здоровья, Бетесда, Мэриленд, США,

Керри Кейси

1 Департамент респираторных заболеваний, воспалений и аутоиммунитета, MedImmune LLC, Гейтерсберг, Мэриленд, США,

1 Департамент респираторных заболеваний, воспалений и аутоиммунитета, MedImmune LLC, Гейтерсберг, Мэриленд, США,

2 Отделение системных аутоиммунных заболеваний, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здравоохранения, Бетесда, Мэриленд, США,

3 Программа клинических исследований волчанки, Офис клинического директора, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальные институты здравоохранения, Бетесда, Мэриленд, США,

4 Секция иммунорегуляции, Отделение аутоиммунитета, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здравоохранения, Бетесда, Мэриленд, США,

Автор, ответственный за переписку. Переписка с Dr Kerry A Casey, Институт иммунологии Аллена, Сиэтл 98109, Вашингтон, США; [email protected]; Д-р Мариана Дж. Каплан, Отделение системных аутоиммунных заболеваний, Национальный институт артрита, заболеваний опорно-двигательного аппарата и кожи, Национальный институт здравоохранения, Бетесда 20892, Мэриленд, США; [email protected]

MJK и KAC являются старшими авторами.

Поступила в редакцию 19 окт. 2018 г.; Пересмотрено 8 марта 2019 г.; Принято 12 марта 2019 г.

Copyright © Автор(ы) (или их работодатель(и)) 2019.Повторное использование разрешено в соответствии с CC BY-NC. Нет коммерческого повторного использования. См. права и разрешения. Опубликовано BMJ. Это статья с открытым доступом, распространяемая в соответствии с некоммерческой лицензией Creative Commons Attribution (CC BY-NC 4.0), которая позволяет другим распространять, ремикшировать, адаптировать, использовать эту работу в некоммерческих целях и лицензировать свои производные работы на других условиях, при условии, что оригинальная работа правильно процитирована, указана соответствующая ссылка, указаны любые внесенные изменения, а использование является некоммерческим.См.: http://creativecommons.org/licenses/by-nc/4.0/. Эта статья цитируется в других статьях PMC.

Abstract

Цели

Наличие провоспалительных гранулоцитов низкой плотности (LDG) было продемонстрировано при аутоиммунных и инфекционных заболеваниях. Недавно регуляторные нейтрофильные полиморфноядерные супрессорные клетки миелоидного происхождения (PMN-MDSC) были идентифицированы при системной красной волчанке (СКВ). Поскольку LDG и PMN-MDSC имеют сходный фенотип с контрастирующими функциональными эффектами, мы исследовали эти клетки в когорте пациентов с СКВ.

Методы

ЛДГ и гранулоциты нормальной плотности (НДГ) выделяли из свежей крови здоровых доноров (ГД) и больных СКВ. Были проанализированы ассоциации между LDG и клиническими проявлениями. Для иммунофенотипирования клеток проводили многоцветную проточную цитометрию и конфокальную визуализацию. Количественно определяли способность LDG и NDG подавлять функцию Т-клеток и индуцировать продукцию цитокинов.

Результаты

Распространенность ЛДГ была выше при СКВ по сравнению с БХ, что ассоциировалось с сигнатурой гена интерферона (ИФН) 21 и активностью заболевания.Кроме того, отношение ЛДГ к лимфоцитам лучше связано с индексом активности заболевания СКВ, чем отношение нейтрофилов к лимфоцитам. SLE LDG проявляет значительно повышенную поверхностную экспрессию различных маркеров активации, а также лектиноподобного окисленного рецептора липопротеинов низкой плотности-1, ранее описанного как связанного с PMN-MDSC. Супернатанты от SLE LDG не ограничивали пролиферацию HD CD4 + Т-клеток зависимым от аргиназы образом, что позволяет предположить, что LDG не являются иммуносупрессивными. Супернатанты SLE LDG индуцировали продукцию провоспалительных цитокинов (IFN-гамма, фактор некроза опухоли альфа и лимфотоксин альфа) из CD4 + Т-клеток.

Выводы

На основании наших результатов СКВ ЛДГ проявляют активированный фенотип, оказывают провоспалительное действие на Т-клетки и не проявляют функции MDSC. Эти результаты подтверждают концепцию о том, что ЛДГ представляют собой отдельную провоспалительную субпопуляцию при СКВ с патогенным потенциалом, по крайней мере, частично, благодаря их способности активировать хелперные реакции 1-го типа.

Ключевые слова: Т-клетки, системная красная волчанка, аутоиммунные заболевания

Ключевые сообщения клетки) свойства.Обе популяции были зарегистрированы при системной красной волчанке (СКВ).

  • СКВ ЛДГ демонстрируют активированный фенотип, не подавляют Т-клетки и стимулируют ответы Th2.

  • Активированная СКВ ЛДГ также экспрессирует лектиноподобный окисленный рецептор липопротеинов низкой плотности-1.

  • Гранулоциты нормальной плотности при СКВ, но не ЛДГ, могут подавлять Т-клетки зависимым от аргиназы образом.

  • Введение

    Популяция нейтрофилов низкой плотности была выявлена ​​в популяции мононуклеарных клеток периферической крови пациентов с системной красной волчанкой (СКВ) в 1986 году. 1 С тех пор об этих клетках сообщалось при других аутоиммунных, раковых и инфекционных заболеваниях с провоспалительным (гранулоциты низкой плотности, LDG) или супрессивным действием (нейтрофильные полиморфноядерные супрессорные клетки миелоидного происхождения, PMN-MDSC). 2–6 Провоспалительная природа ЛДГ при СКВ была продемонстрирована их способностью секретировать фактор некроза опухоли альфа (ФНО-α), гамма-интерферон (ИФН)-γ и ИФН I типа, цитокины, часто участвующие в патогенезе заболевания. 3 LDG также являются мощными производителями нейтрофильных внеклеточных ловушек (NET), которые стимулируют выработку IFN типа I плазмоцитоидными дендритными клетками (pDC) и непосредственно способствуют дисфункции эндотелиальных клеток и повреждению сосудов. 7–10 У пациентов с СКВ с повышенным количеством циркулирующих ЛДГ также наблюдается повышенная распространенность поражения кожи, васкулитов, воспаления артерий и коронарных бляшек. 3 11

    Напротив, PMN-MDSC были описаны как иммунорегуляторные из-за их способности подавлять пролиферацию Т-клеток при инфекционных, аутоиммунных, раковых и метаболических заболеваниях. 12–16 Иммуносупрессивные механизмы, опосредуемые PMN-MDSC, включают поверхностную экспрессию различных ингибиторов контрольных точек (лиганд запрограммированной смерти 1 [PD-L1], лиганд запрограммированной смерти 2 [PD-L2] и CD73), наряду с высвобождением ферментативные или химические медиаторы (аргиназа-1 [Arg1] и синтаза оксида азота). 17 В когорте пациентов с волчаночным нефритом СКВ PMN-MDSC опосредовала супрессию Arg1-зависимым образом, подобно тому, что было описано при множественных онкологических заболеваниях. 14 Многогранная роль этих подмножеств нейтрофилов низкой плотности при различных показаниях подчеркивает их важность при заболеваниях человека. 18 19

    Несмотря на противоположные функции, LDG и PMN-MDSC были зарегистрированы при СКВ с сильной связью с индексом активности заболевания СКВ (SLEDAI). 3 14 Примечательно, что обе подгруппы используют для идентификации перекрывающиеся маркеры поверхности нейтрофилов, включая CD11b + , CD33 + , CD15 + (или CD66b) и изотип человеческого лейкоцитарного антигена-DR (HLA-DR — 90) , после исключения других маркеров линии (LIN) (CD3, CD19, CD20 и CD56). 19 20 Хотя эти подмножества рассматриваются как незрелые нейтрофилы с пониженной плотностью, большинство идентифицирующих маркеров также являются общими для зрелых терминально дифференцированных гранулоцитов нормальной плотности (NDG).Ввиду общего сходства всестороннее и сравнительное иммунофенотипирование активационных и регуляторных маркеров на аналогах с низкой и нормальной плотностью еще предстоит выполнить в контексте связи этих клеток с активностью заболевания СКВ и понимания их отношения к типу. I оси IFN и других компонентов этого заболевания. Кроме того, при СКВ остается неясным, как аналоги с низкой плотностью и нормальной плотностью функционально сравниваются по их способности оказывать влияние на Т-клетки.В результате существует неясность в отношении идентичности, природы и роли этих подмножеств низкой плотности в аутоиммунном пространстве, особенно при СКВ. 21 22

    Чтобы устранить эти пробелы в знаниях, мы выполнили иммунофенотипическую, морфологическую и функциональную характеристику этой подгруппы нейтрофилов и сравнили их с аутологичными NDG в хорошо охарактеризованной когорте СКВ, состоящей как из клинически неактивных, так и из активных пациентов. Мы предположили, что эта более крупная когорта, представленная по всему спектру заболеваний, обеспечит лучшее понимание функциональных и фенотипических особенностей этих клеток.Используя этот подход, мы оценили, связаны ли ЛДГ волчанки (i) с активностью заболевания и, более конкретно, с путем I IFN, (ii) проявляются ли какие-либо регуляторные эффекты PMN-MDSC через ранее описанные механизмы и (iii) отличаются ли от соответствующих NDG по этим различным фенотипическим и функциональным аспектам. Поскольку большая часть опубликованной литературы по СКВ относится к этой аномальной подгруппе нейтрофилов как к ЛДГ, в дальнейшем мы будем использовать ту же терминологию.

    Результаты

    Обзор когорты больных СКВ

    Демографические и клинические данные для здоровых доноров (ГД) и пациентов с СКВ обобщены в .Не было существенной разницы ни по полу, ни по среднему возрасту. Средний балл SLEDAI составил 2 с диапазоном от 0 до 13.

    Таблица 1

    Таблица 1

    Демография и клинические характеристики HD и пациентов с волчанкой Исследованы в этом исследовании

    1 SLU 1 Секс (м / е), N Автоматические антитела (% положительный)

    1 18

    1

    1 Biologics (Белимумаб / ритуксан)

    1 —

    HD *
    М=7, Ж=73 М=6, Ж=88
    Возраст, лет (медиана, диапазон) 45 (35–65)† 40 (15–73)
    4 SLED (медиана, диапазон) 2 (0–13)
    С3, мг/дл (медиана, диапазон) 95.5 (44.8-184.9)
    C4, MG / DL (медиана, диапазон) 16,7 (2.2-43.3)
    ESR, мм / час (медианы, диапазон) 23 (2-100)
    CRP, MG / L (медиана, диапазон) 1,7 (0.15-31.4)
    Anti-DSDNA 70
    АНА 95
    ЛАК 28
    ЕСА 85
    Лекарства (%) §
    Пероральные кортикостероиды 21
    гидроксихлорохин 83
    азатиоприна 76
    Циклофосфамид 19
    Мофетил mofetil 18
    Methotrexate
    5
    5

    Увеличение LDG в СКТ-спецтехники с подписью и болезнью гена IFN степень тяжести

    Предыдущие исследования показали повышенное присутствие ЛДГ у пациентов с СКВ. 1 3 14 Мы изучили эти результаты, оценив распространенность этих клеток в нашей когорте пациентов с БХ и СКВ. Были включены поверхностные маркеры, ранее описанные как в аутоиммунных, так и в онкологических исследованиях, необходимые для их идентификации. 19 20 ЛДГ, очищенные центрифугированием в градиенте плотности, идентифицированы как LIN (CD3/CD19/CD20/CD56), HLA-DR , CD11b + , CD33 + , 0515 90 (). Распространенность ЛДГ была достоверно увеличена у пациентов с СКВ в 2 раза.9-кратное (; среднее HD ± SEM = 0,81% ± 0,16; среднее SLE ± SEM = 2,37% ± 0,45) и абсолютное количество в 11,5 раз (; среднее HD ± SEM = 0,28 ± 0,05; среднее SLE ± SEM = 3,22 ± 0,53). Кроме того, количество LDG продемонстрировало значительную положительную связь с оценкой SLEDAI (). В соответствии с сильной связью с SLEDAI наблюдалось, что LDG в 1,6 раза выше у активных пациентов по сравнению с неактивными (среднее значение неактивной СКВ ± SEM = 2,48 ± 0,71; среднее значение активной СКВ ± SEM = 4,05 ± 0,79), что позволяет предположить их тесную связь с активность болезни. Чтобы понять, связана ли наблюдаемая тесная связь с SLEDAI со специфическими клиническими проявлениями, числа ЛДГ были оценены на предмет связи с различными клиническими параметрами и в значительной степени связаны с повышенным связыванием ДНК (p = 0.0165) и низкий уровень комплемента (p = 0,0187) (онлайн-дополнительная таблица S1). Наблюдаемое увеличение количества LDG при СКВ по сравнению с HD и его связь с SLEDAI подтверждают предыдущие наблюдения и демонстрируют эффективность когорты для целей нашего исследования.

    Повышенная распространенность ЛДГ при СКВ связана с тяжестью заболевания и IFNGS. Частота циркулирующего ЛДГ анализировалась и коррелировала с тяжестью заболевания. (A) Стратегия гейтирования проточной цитометрии для выявления LDG в PBMC человека.Распространенность ЛДГ при БХ и у пациентов с СКВ (здоровые n=80; СКВ n=94) как (B) частота CD45 (HD среднее ±SEM=0,81±0,16; SLE среднее±SEM=2,37±0,45; p<0,0001) и (C) абсолютные числа (среднее значение HD ± SEM = 0,28 ± 0,05 × 10 6 / мл; среднее SLE ± SEM = 3,22 ± 0,53 × 10 6 / мл; p <0,0001). (D) Связь между количеством LDG у здоровых, а также у неактивных и активных пациентов с СКВ (здоровые n = 80; неактивные n = 50; активные n = 44) на основе SLEDAI (среднее значение неактивных пациентов ± SEM = 2,48 ± 0,71 × 10 6 /мл, активные пациенты с СКВ, среднее ±SEM=4.05±0,79×10 6 /мл; р=0,02]. (E) Ассоциация между IFNGS (низкий n = 20; высокий n = 22) и распространенностью LDG у пациентов с СКВ с низким (среднее ± SEM = 0,04 ± 0,01) и высоким (среднее ± SEM = 1,10 ± 0,30; p < 0,0001) ИФНГС. Взаимосвязь между (F) соотношением нейтрофилов: лимфоцитов и (G) соотношением ЛДГ: лимфоцитов с SLEDAI. Отдельный символ представляет одного донора, и показано среднее значение ± стандартная ошибка среднего. HD, здоровые доноры; HLA-DR, изотип человеческого лейкоцитарного антигена-DR; IFNGS, сигнатура 21 гена интерферона; ЛДГ, гранулоциты низкой плотности; ЛИН, родословная; PBMC, мононуклеарные клетки периферической крови; СКВ, системная красная волчанка; SLEDAI — индекс активности заболевания СКВ; SSC, боковой разброс.

    Путь ИФН I типа играет важную роль в патогенезе заболевания и обострении СКВ и других ревматических заболеваний. 23–25 LDG, которые подвергаются усиленному образованию NET, приводят к экстернализации модифицированной внеклеточной ДНК. 26 27 Материал, высвобождаемый из NET, стимулирует pDC к высвобождению IFN-α и миелоидным клеткам к высвобождению IFN типа I. 7 28 29 В то время как ЛДГ может приводить к продукции ИФН I типа in vitro, связь между ЛДГ и ИФН I типа in vivo остается неизвестной.Чтобы решить эту проблему, мы оценили взаимосвязь между ЛДГ и генами, регулируемыми ИФН I типа. 30 Частота LDG была значительно выше у пациентов с высокой по сравнению с низкой сигнатурой гена IFN I типа (IFNGS; низкое среднее ±SEM=0,04%±0,0; высокое среднее±SEM=1,10%±0,30; p<0,0001). Это демонстрирует сильную связь между присутствием ЛДГ как с клинической активностью, так и с активацией пути IFN I типа.

    В то время как IFNGS является надежным предиктором воспаления, вызванного IFN I типа, общее отношение нейтрофилов к лимфоцитам (NLR) является другим часто используемым индикатором воспаления, который охватывает многие пути помимо IFN I типа. 31 32 Учитывая значительно увеличенное количество ЛДГ при СКВ, мы сравнили NLR и оценили полезность отношения LDG к лимфоцитам (LLR) в качестве нового и улучшенного предиктора воспаления. В нашей когорте, в то время как NLR продемонстрировал значительную разницу между активными и неактивными пациентами с СКВ (p = 0,003), он не выявил значительных различий между неактивными пациентами с СКВ и HD (p = 0,09) (). Напротив, LLR обеспечивает лучшее разрешение и разделение между одними и теми же неактивными пациентами с СКВ и ГБ (p<0,0.0001) (). Этот результат предполагает, что LLR может быть более чувствительным индикатором иммунной дисрегуляции, чем NLR. Было бы интересно дополнительно подтвердить полезность LLR по сравнению с NLR при других заболеваниях.

    СКВ ЛДГ проявляют активированный иммунофенотип

    Увеличение распространенности ЛДГ по всему спектру заболеваний подтвердило полезность нашей когорты для дальнейшего анализа. Хотя LDG и PMN-MDSC имеют сходный иммунофенотип, они демонстрируют различия в уровнях экспрессии различных активационных и регуляторных маркеров, основанные на их контрастных функциях. 19 Регуляторные маркеры, связанные с супрессивной активностью PMN-MDSC, включают Arg1, CD73, CD274 (PD-L1) и CD273 (PD-L2), 13 15 , тогда как маркеры дегрануляции, связанные с провоспалительной ролью нейтрофилов, включают CD63 ( ассоциированный с лизосомой мембранный гликопротеин (LAMP)-3) и CD107a (LAMP-1). 33 Экспрессия рецептора-1 лектиноподобного окисленного липопротеина низкой плотности (oxLDL) (LOX-1) однозначно экспрессируется с помощью PMN-MDSC при раке; однако его способность отличать MDSC от LDG при СКВ остается неизученной. 34 Неизвестно, как уровни экспрессии этих маркеров сравниваются между LDG и NDG. Чтобы ответить на эти вопросы, было проведено иммунофенотипирование как LDG, так и соответствующего NDG от HD и пациентов с СКВ. Сначала мы изучили иммунофенотипический профиль ЛДГ между БХ и пациентами с СКВ (14). Поскольку LDG имеет сходные фенотипические маркеры с NDG, мы затем сравнили профиль экспрессии двух типов клеток при СКВ () и HD (онлайн-дополнительный рисунок S1).

    ЛДГ проявляют активированный фенотип при СКВ.И NDG, и LDG от HD и SLE были фенотипированы для различных активационных и регуляторных маркеров (здоровые n = 20; SLE n = 20). Фенотипирование (A) маркеров активации и (B) регуляторных маркеров ЛДГ при БХ по сравнению с СКВ. Фенотипирование (C) активации и (D) регуляторных маркеров NDG по сравнению с LDG у пациентов с СКВ. Отдельный символ представляет одного донора, и показано среднее геометрическое MFI ± SEM. Бар , представляющий геометрическое значение MFI, слишком низкое для наблюдения. Arg1, аргиназа-1; HD, здоровые доноры; ЛДГ, гранулоциты низкой плотности; LOX-1, лектиноподобный окисленный рецептор липопротеинов низкой плотности-1; MFI, средняя интенсивность флуоресценции; NDG, гранулоциты нормальной плотности; СКВ, системная красная волчанка.

    За исключением внутриклеточного Arg1 и CD63, не наблюдалось существенной разницы для других маркеров между LDG от HD и SLE (). Однако, когда СКВ LDG сравнивали с аутологичным NDG, наблюдались значительные различия (). В частности, экспрессия LDG была значительно выше (LOX-1, CD63, CD107a и CD274), снижена (внутриклеточный Arg1, CD273 и CD95) или не отличалась (CD73) в уровнях экспрессии исследованных маркеров (и HD на дополнительном онлайн-рисунке S1). За исключением CD274, ни один из других ингибиторов контрольных точек (CD273 и CD73) не был значительно повышен на LDG по сравнению с NDG (12).Примечательно, что значительно более высокая экспрессия маркеров дегрануляции (CD63 и CD107a) и сниженный внутриклеточный Arg1 при СКВ LDG по сравнению с NDG предполагает их повышенный статус активации (12). Особый интерес представляла значительно более высокая поверхностная экспрессия LOX-1 и CD63 при СКВ LDG по сравнению с NDG.

    Эти результаты подтверждают и расширяют представление о том, что СКВ ЛДГ и НДГ различаются иммунофенотипически. Основываясь на более высокой поверхностной экспрессии маркеров дегрануляции, SLE LDG демонстрирует активированный иммунофенотип с сопутствующей экспрессией LOX-1.

    СКВ ЛДГ экспрессируют LOX-1 и демонстрируют другую морфологию по сравнению с NDG

    Повышенная экспрессия как LOX-1, так и CD63 на ЛДГ при СКВ ранее не описывалась. Хотя недавно было высказано предположение, что LOX-1 однозначно экспрессируется супрессивными PMN-MDSC, CD63 является маркером активации гранулоцитов. 33 34 LDG и аутологичный NDG от пациентов с СКВ анализировали с помощью конфокальной визуализации для изучения различий в окрашивании LOX-1/CD63 и морфологии. В то время как NDG, идентифицированный по характерным многодольчатым ядрам, демонстрировал тусклое окрашивание LOX-1/CD63, LDG с более гетерогенной ядерной морфологией, включая полосчатые ядра, включала четыре субпопуляции на основе переменных уровней экспрессии LOX-1 и CD63 (1).Экспрессия LOX-1 на LDG была подтверждена на уровне мессенджера (1). Эти данные предполагают, что SLE LDG экспрессирует LOX-1, и он коэкспрессируется с CD63 на различных уровнях.

    SLE LDG экспрессируют LOX-1 и демонстрируют другую морфологию по сравнению с аутологичным NDG. (A) Репрезентативные конфокальные изображения аутологичных СКВ NDG и LDG и относительный процент подгрупп LDG. Популяция LOX-1 hi /CD63 hi была дополнительно охарактеризована по морфологии (данные репрезентативны для пяти пациентов с СКВ).(B) Уровни экспрессии мРНК LOX-1 при СКВ NDG и LDG (данные репрезентативны для пяти пациентов с СКВ). (C–G) Количественная сравнительная оценка различных морфологических параметров между SLE NDG и LOX-1 hi CD63 hi популяция LDG, (C) количество ядерных долей, (D) площадь ядра (среднее значение NDG ± SEM = 160 ± 7,4 мкм 2 ; среднее значение LDG ± стандартная ошибка среднего = 101 ± 3,4 мкм 2 ; p < 0,0001), (E) площадь клетки (среднее значение NDG ± стандартная ошибка среднего = 315 ± 14,6 мкм 2 ; среднее значение LDG ± стандартная ошибка среднего = 245 ± 9 мкм 2 р<0.0001), (F) ядерно-цитоплазматическое отношение (среднее значение NDG ± SEM = 0,89 ± 0,07; среднее значение LDG ± SEM = 0,6 ± 0,03; p <0,0001) и (G) диаметр клеток (среднее значение NDG ± SEM = 14 ± 0,72). мкм; среднее значение LDG±SEM=11,7±0,41 мкм; p<0,0001). Показаны данные, собранные у пяти пациентов с СКВ, с отдельным символом, представляющим одну клетку, и средним значением ± стандартная ошибка среднего. Масштабная линейка на изображение составляет 10 мкм. ЛДГ, гранулоциты низкой плотности; LOX-1, лектиноподобный окисленный рецептор липопротеинов низкой плотности-1; NDG, гранулоциты нормальной плотности; СКВ, системная красная волчанка.

    Коэкспрессирующая популяция LOX-1 hi /CD63 hi () была выбрана для дальнейшей количественной морфологической оценки.Количественно у LDG было меньше ядерных долей по сравнению с аутологичным NDG (; среднее значение LDG ± SEM = 2,3 ± 0,09; среднее значение NDG ± SEM = 3,8 ± 0,06). По сравнению со своими аналогами NDG, LDG продемонстрировали значительно уменьшенную площадь ядра, площадь клеток, диаметр клеток, а также более низкое отношение ядра к цитоплазме (12). Таким образом, LDG представляют собой отличную морфологию по сравнению с NDG на основе различных исследованных ядерных и клеточных параметров.

    СКВ NDG, но не LDG, ограничивает пролиферацию CD4

    + Т-клеточная пролиферация зависимым от аргиназы образом

    Поскольку СКВ LDG экспрессирует LOX-1, который, как недавно предполагалось, уникально экспрессируется супрессивным PMN-MDSC, мы оценили клетки за их подавляющую способность. 34 LDG оценивали на предмет их способности подавлять пролиферацию CD4 + Т-клеток как в контактно-независимых, так и в контактно-зависимых условиях. Для контактно-независимой супрессии был оценен аргиназный механизм, который, как было показано ранее, используется PMN-MDSC и активированными нейтрофилами. 14 35 NDG и LDG, выделенные от пациентов с СКВ, лечили в течение ночи в отсутствие или в присутствии ингибитора аргиназы nor-NOHA. Затем супернатант от таких обработанных клеток добавляли к свежевыделенным здоровым наивным CD4 + Т-клеткам, которые были активированы шариками анти-CD3/CD28.В качестве положительного контроля было обнаружено, что экзогенно добавленная аргиназа ингибирует пролиферацию Т-клеток дозозависимым образом, и это было нейтрализовано ее ингибитором nor-NOHA (12). В то время как SLE NDG значительно снижала пролиферативную способность активированных контрольных CD4 + Т-клеток по сравнению с контрольными шариками (p = 0,0006), эффект, обратимый nor-NOHA (p = 0,02), SLE LDG не ограничивал пролиферацию Т-клеток () . Кроме того, ни NDG, ни LDG, выделенные из HD, не продемонстрировали никакого супрессивного действия на Т-клетки (дополнительная онлайн-рисунок S2B).Даже в контактно-зависимых условиях СКВ ЛДГ не ингибировала пролиферацию Т-клеток (дополнительная онлайн-рисунок S2C). На эти результаты не повлиял осмотический стресс из-за обработки лизисом эритроцитов (дополнительный онлайн-рисунок S3).

    СКВ ЛДГ не ограничивают пролиферацию CD4 + Т-клеток. Как NDG, так и LDG у пациентов с СКВ оценивали на их способность ограничивать пролиферацию Т-клеток в аргиназо-зависимом анализе. Относительное количество HD-пролиферирующих CD4 + Т-клеток рассчитывали через 72 часа при совместном культивировании с супернатантом СКВ NDG или LDG, которые культивировали в течение ночи в отсутствие или в присутствии ингибитора аргиназы, nor-NOHA.(A) Репрезентативные графики и (B) относительное количество Т-клеток (нормализованное по отношению к контролям шариков CD3/CD28) для различных контрольных условий из трех независимых экспериментов. (C) Относительное количество Т-клеток (нормированное к контрольным шарикам CD3/CD28) при культивировании с супернатантом NDG или LDG, которое культивировали в течение ночи в отсутствие или в присутствии nor-NOHA (объединенные данные шести пациентов с СКВ в трех независимых экспериментах). ). (D) Количественное определение биоактивной аргиназы, присутствующей в супернатанте тестовых условий NDG и LDG (показаны объединенные данные от шести пациентов с СКВ и среднее ± SEM).Одна единица аргиназы — это количество фермента, которое превращает 1,0 мкмоль L-аргинина в орнитин и мочевину в минуту при pH 9,5 и 37°C. HD, здоровые доноры; ЛДГ, гранулоциты низкой плотности; NDG, гранулоциты нормальной плотности; NOHA, N ω -гидрокси-нор-аргинин; СКВ, системная красная волчанка.

    В соответствии с повышенной подавляющей способностью волчаночного NDG в подавлении пролиферации Т-клеток с помощью независимого от контакта механизма было обнаружено, что эти клетки выделяют в 3,3 раза более высокую биоактивную аргиназу, чем LDG (; среднее значение NDG ± стандартная ошибка среднего = 27.27±3,2 ферментных единиц; Среднее значение ЛДГ ± SEM = 8,17 ± 3,3 ферментных единиц; р=0,008). Синтез аргиназы NDG при СКВ снижался в 3,9 раза после обработки nor-NOHA (среднее значение NDG — nor-NOHA ± стандартная ошибка среднего = 27,27 ± 3,2 единицы фермента; среднее значение NDG + nor-NOHA ± стандартная ошибка среднего = 6,87 ± 2,3 единицы фермента). LDG не показал существенной разницы в количестве синтезированной аргиназы в отсутствие или в присутствии nor-NOHA. Это также подтверждает наше наблюдение, что SLE NDG имеет в 1,8 раза более высокую внутриклеточную среднюю геометрическую интенсивность флуоресценции Arg1, чем LDG (среднее значение NDG ± SEM = 4996 ± 269; среднее значение LDG ± SEM = 2817 ± 285).Кроме того, не наблюдалось существенной разницы в уровнях высвобождаемой биоактивной аргиназы между HD NDG и аутологичным LDG (дополнительный онлайн-рисунок S2D). Эти результаты свидетельствуют о том, что ЛДГ при СКВ не ингибирует пролиферацию Т-клеток как в контактно-независимых, так и в контактно-зависимых условиях. Кроме того, подавление пролиферации Т-клеток при СКВ, вызванное NDG, в условиях, не зависящих от контакта, в первую очередь опосредуется внутриклеточной аргиназой, которая спонтанно высвобождается клетками в своей биоактивной форме.

    СКВ ЛДГ индуцирует профиль провоспалительных Т-лимфоцитов

    Было показано, что как ЛДГ, так и PMN-MDSC управляют своими соответствующими функциями и последующими эффектами на другие клетки посредством продукции ключевых цитокинов, включая IFN-γ и интерлейкин 10. 3 17 Учитывая существенные различия между NDG и LDG в их иммунофенотипическом профиле и способности подавлять пролиферацию Т-клеток, мы исследовали влияние этих типов клеток на продукцию цитокинов Т-клетками. Супернатант клеточных культур анализировали на различные цитокины с помощью мультиплексного анализа Meso Scale Discovery.Только SLE LDG была способна индуцировать значительно более высокую продукцию провоспалительных цитокинов Th2 IFN-γ, TNF-α и лимфотоксина альфа, чем контрольные гранулы (1). Эти цитокины не были обнаружены в супернатантах от LDG или NDG (данные не показаны). Другие исследованные цитокины и хемокины либо существенно не различались, либо не были обнаружены (онлайн-дополнительная таблица S2). В целом, функциональный и фенотипический анализ этих клеток подтверждает, что ЛДГ волчанки представляет собой провоспалительное подмножество, которое может активировать адаптивные иммунные ответы.

    СКВ ЛДГ индуцирует профиль провоспалительных Т-клеток цитокинов. Нормализованное количественное определение (A) IFN-γ, (B) TNF-α и (C) LT-α из пролиферирующих культур Т-клеток, которые были культивированы с супернатантами, полученными либо из NDG, либо из LDG пациентов с СКВ (объединенные данные от шести пациентов с SLE и показано среднее ± SEM). IFN-γ, гамма-интерферон; ЛДГ, гранулоциты низкой плотности; LT-α, лимфотоксин альфа; NDG, гранулоциты нормальной плотности; СКВ, системная красная волчанка; TNF-α, фактор некроза опухоли альфа.

    Обсуждение

    Область биологии нейтрофилов значительно изменилась за последнее десятилетие, и некоторые прорывы были связаны с ролью субпопуляций нейтрофилов низкой плотности в аутоиммунитете, инфекционных заболеваниях и раке. 15 36 LDG и PMN-MDSC оказывают противоположное функциональное воздействие на Т-клетки, при этом LDG оказался стимулирующим, а PMN-MDSC подавляющим. В отсутствие отличительных маркеров необходимы дополнительные функциональные анализы, чтобы охарактеризовать эти подмножества как провоспалительные или супрессивные.Параллельный анализ нейтрофилов низкой плотности и нормальной плотности дает важный контекст для интерпретации иммунофенотипических и функциональных исследований. В то время как предыдущие исследования СКВ изучали эти подмножества нейтрофилов низкой плотности, существуют противоречивые сообщения об их функции и роли в заболевании. 3 14 21 22 Хотя стратегия иммунофенотипической идентификации, использованная Wu et al. , аналогична подходу, использованному в нашем исследовании (CD11b+CD33+HLA-DR ), эти исследователи обозначали клетки как PMN-MDSC. из-за наблюдаемых у них подавляющих функций. 14 В наших руках эти клетки проявляли провоспалительные функции. В когорте, изученной Wu и соавт. , наблюдалась высокая активность заболевания, и у большинства пациентов был люпус-нефрит, что могло лежать в основе наблюдаемых различий в функциях. Кроме того, в наших руках метод сортировки клеток, использованный Wu et al , может значительно изменить функциональные характеристики гранулоцитов и миелоидных клеток (неопубликованные наблюдения).

    При множественных раковых заболеваниях было продемонстрировано, что LOX-1 экспрессируется на высоких уровнях на супрессивных PMN-MDSC по сравнению с их аналогами нормальной плотности, и поэтому был предложен в качестве маркера PMN-MDSC. 34 Здесь мы впервые демонстрируем повышенную поверхностную экспрессию LOX-1 на провоспалительных LDG при аутоиммунном заболевании. LOX-1 представляет собой поглощающий рецептор класса E для oxLDL, и при воспалительных заболеваниях, таких как СКВ, повышенный уровень oxLDL может индуцировать гранулоцитарную активацию и дегрануляцию. 37–44 При раке LOX-1 связан с супрессивной активностью, но не требуется для регуляторной функции. 34 Экспрессия LOX-1 может быть вызвана стрессом эндоплазматического ретикулума, общим признаком как рака, так и аутоиммунитета. 34 45 По этим причинам при аутоиммунных заболеваниях LOX-1 не следует использовать для оценки того, является ли нейтрофил иммунодепрессантным или провоспалительным.

    Действительно, несмотря на то, что СКВ ЛДГ экспрессируют LOX-1, они не проявляют какой-либо значительной способности подавлять Т-клетки ни в контактно-независимых, ни в контактно-зависимых анализах. Напротив, здесь мы продемонстрировали супрессию, опосредованную переносом супернатантов из ночных культур только NDG волчанки. Мы наблюдали, что спонтанно высвобождаемый биоактивный Arg1 из SLE NDG был в 5 раз выше, чем HD NDG.Метаболизм внеклеточного аргинина через Arg1, высвобождаемый из PMN-MDSC или нейтрофильных азурофильных гранул, является ключевым механизмом, с помощью которого эти клетки, как полагают, оказывают свое супрессивное действие на Т-клетки. 46–48 В соответствии с возможным участием этого механизма в заболевании сообщалось о повышенных уровнях Arg1 в сыворотке пациентов с аутоиммунитетом, раком и инфекционными заболеваниями. 49–51 Повышенная подавляющая способность СКВ NDG также может быть связана с наличием активированных нейтрофилов у таких пациентов с повышенным нейтрофильным сидерофорным липокалином-2 (LCN2/NGAL), который может эффективно связывать и удалять железо. 52 Секвестрация железа, ключевого питательного вещества для Т-лимфоцитов, из микроокружения отрицательно влияет на пролиферацию Т-лимфоцитов. 53 Способность высвобождать значительно больше биоактивной аргиназы в сочетании с повышенным содержанием LCN2 позволяет NDG у пациентов с СКВ быть лучшими супрессорами пролиферации Т-клеток, чем HD NDG. Наши данные свидетельствуют о том, что при СКВ Arg1-зависимая супрессия в первую очередь опосредуется NDG, а не LDG. В то время как супернатант NDG не влиял на выработку цитокинов CD4 T-клетками, супернатант LDG стимулировал провоспалительный ответ цитокинов Th2, что еще раз подтверждало их роль в качестве движущих сил воспаления.Такие клетки, продуцирующие цитокины Th2, были обнаружены в большом количестве в почках пациентов с волчаночным нефритом и также коррелировали с гистологической активностью заболевания. 54–56

    Было показано, что при СКВ ЛДГ очень восприимчивы к образованию НЭО, процессу, который может привести к иммунной дисрегуляции и активации pDC и миелоидной оси IFN I и индукции IFNGS. 7 30 Мы впервые продемонстрировали прямую положительную корреляцию между ЛДГ и IFNGS, предполагая тесную связь между присутствием этих клеток и активацией пути IFN I типа.Таким образом, будущие исследования должны выяснить, наблюдаются ли аналогичные корреляции при других воспалительных заболеваниях, где считается, что путь IFN I играет важную роль в патогенезе. Дальнейшее понимание взаимосвязей между аберрантными субпопуляциями нейтрофилов и путем IFN I типа при СКВ может обеспечить идентификацию дополнительных терапевтических мишеней при этом заболевании.

    В заключение мы демонстрируем, что СКВ ЛДГ представляет собой патогенное подмножество, связанное с активацией IFN I типа и с развитием несупрессивной активации Т-клеток при этом заболевании.Наблюдаемая провоспалительная роль ЛДГ подтверждает их предполагаемую патогенную роль при СКВ.

    Благодарности

    Данные представлены на конференции Neutrophil 2018 (http://theneutrophil.com). Это исследование было частично поддержано программой внутренних исследований NIAMS/NIH AR041199 и компанией MedImmune, входящей в группу AstraZeneca. В настоящее время DS является сотрудником Eli Lilly and Company (Индианаполис, Индиана, США), YLL является сотрудником Онкологического центра М.Д. Андерсона Техасского университета (Хьюстон, Техас, США), RMS является сотрудником Novartis (Базель, Швейцария) , MAS — сотрудник компании Bristol-Myers Squibb (Нью-Йорк, штат Нью-Йорк, США), а KAC — сотрудник Института иммунологии Аллена (Сиэтл, штат Вашингтон, США; [email protected]). Редакционную поддержку оказала компания JK Associates Inc., входящая в группу компаний Fishawack. Эта поддержка была профинансирована MedImmune.

    Сноски

    Ответственный редактор: Йозеф С. Смолен

    Авторы: SR, RMS, MAS, RK, MJK и KAC задумали и разработали исследование. SR, DS, RNH, YLL, PM, CKS, ZM и SH провели эксперименты и собрали данные. SR, DS, RNH, YLL, PM, CKS и SH проанализировали и интерпретировали данные.Все авторы принимали участие в разработке, рецензировании и утверждении рукописи.

    Конкурирующие интересы: SR, RNH и RK являются сотрудниками MedImmune. DS, MAS и KAC были сотрудниками MedImmune в то время, когда проводилась работа над этим исследованием. Другим авторам нечего декларировать.

    Согласие пациента на публикацию: Не требуется.

    Происхождение и экспертная оценка: Не введен в эксплуатацию; рецензируется внешними экспертами.

    Каталожные номера

    1.Хакбарт Э., Кайдачи-Балла А. Нейтрофилы низкой плотности у больных системной красной волчанкой, ревматоидным артритом и острой ревматической лихорадкой. Артрит Реум 1986; 29: 1334–42. 10.1002/арт.17802 [PubMed] [CrossRef] [Google Scholar]2. Беннетт Л., Палука А.К., Арсе Э. и др. . Признаки интерферона и гранулопоэза в крови при системной красной волчанке. J Эксперт Мед 2003; 197: 711–23. 10.1084/ем.20021553 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]3. Денни М.Ф., Ялаварти С., Чжао В. и др.. Отдельная подгруппа провоспалительных нейтрофилов, выделенных у пациентов с системной красной волчанкой, вызывает повреждение сосудов и синтезирует интерфероны I типа. Дж Иммунол 2010;184:3284–97. 10.4049/иммунол.0

    9 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]4. Сагив Дж.Ю., Михаэли Дж., Асси С. и др. . Фенотипическое разнообразие и пластичность субпопуляций циркулирующих нейтрофилов при раке. Представитель ячейки 2015;10:562–73. 10.1016/j.celrep.2014.12.039 [PubMed] [CrossRef] [Google Scholar]5. Клоук Т., Мундер М., Тейлор Г. и др.. Характеристика новой популяции гранулоцитов низкой плотности, связанных с тяжестью заболевания при ВИЧ-1-инфекции. PLoS один 2012;7:e48939 10.1371/journal.pone.0048939 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]6. Rocha BC, Marques PE, Leoratti FMdeS и др. . Транскрипционная сигнатура интерферона типа I в нейтрофилах и гранулоцитах низкой плотности связана с повреждением тканей при малярии. Представитель ячейки 2015;13:2829–41. 10.1016/j.celrep.2015.11.055 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]7.Вильянуэва Э., Ялаварти С., Бертье К.С. и др. . Сетчатые нейтрофилы индуцируют повреждение эндотелия, инфильтрируют ткани и высвобождают иммуностимулирующие молекулы при системной красной волчанке. Дж Иммунол 2011; 187: 538–52. 10.4049/иммунол.1100450 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]8. Кармона-Ривера С., Чжао В., Ялаварти С. и др. . Нейтрофильные внеклеточные ловушки вызывают дисфункцию эндотелия при системной красной волчанке за счет активации матриксной металлопротеиназы-2.Энн Реум Дис 2015;74:1417–24. 10.1136/annrheumdis-2013-204837 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10. Баррера-Варгас А., Гомес-Мартин Д., Кармона-Ривера С. и др. . Дифференциальное убиквитинирование в сетях регулирует ответы макрофагов при системной красной волчанке. Энн Реум Дис 2018; 77: 944–50. 10.1136/annrheumdis-2017-212617 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]11. Карлуччи П.М., Пурмалек М.М., Дей А.К. и др. . Подмножества нейтрофилов и их генная сигнатура связаны с воспалением сосудов и коронарным атеросклерозом при волчанке.JCI Insight 2018;3 10.1172/jci.insight.99276. [Epub перед печатью: 19 апреля 2018 г.]. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12. Bowers NL, Helton ES, Huijbregts RPH, et al. . Иммунная супрессия нейтрофилами при ВИЧ-1-инфекции: роль пути PD-L1/PD-1. PLoS Патог 2014;10:e1003993 10.1371/журнал.ppat.1003993 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13. Цао Л.И., Чанг Дж.С., Тешима Т. и др. . Супрессорные клетки миелоидного происхождения при псориазе представляют собой расширенную популяцию, демонстрирующую различные механизмы Т-клеточного супрессора.Джей Инвест Дерматол 2016; 136:1801–10. 10.1016/j.jid.2016.02.816 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14. У Х, Жень Ю, Ма З и др. . Зависимое от аргиназы-1 стимулирование дифференцировки T H 17 и прогрессирования заболевания с помощью MDSC при системной красной волчанке. Sci Transl Med 2016;8 10.1126/scitranslmed.aae0482 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]17. Солито С., Мариго И., Пинтон Л. и др. . Гетерогенность супрессорных клеток миелоидного происхождения при раке человека.Энн Н.Ю. Академия наук 2014;1319:47–65. 10.1111/няс.12469 [PubMed] [CrossRef] [Google Scholar] 18. Скапини П., Марини О., Теккио С. и др. . Нейтрофилы человека в саге о клеточной гетерогенности: идеи и открытые вопросы. Иммунол Rev 2016; 273:48–60. 10.1111/имр.12448 [PubMed] [CrossRef] [Google Scholar] 19. Яблонска Дж., Гранот З. Нейтрофилы, quo vadis? Дж. Лейкок Биол 2017; 102: 685–8. 10.1189/jlb.3MR0117-015R [PubMed] [CrossRef] [Google Scholar] 20. Бронте В., Брандау С., Чен С.-Х. и др. . Рекомендации по номенклатуре супрессорных клеток миелоидного происхождения и стандартам характеристики.Нац Коммуна 2016;7 10.1038/ncomms12150 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]23. Хукс Дж. Дж., Мутсопулос Х. М., Гейс С. А. и др. . Иммунный интерферон в кровообращении больных аутоиммунными заболеваниями. N Engl J Med 1979; 301: 5–8. 10.1056/NEJM197

    3010102 [PubMed] [CrossRef] [Google Scholar] 24. Иттерберг С.Р., Шнитцер Т.Дж. Уровни интерферона в сыворотке крови у больных системной красной волчанкой. Артрит Реум 1982; 25: 401–6. 10.1002/арт.1780250407 [PubMed] [CrossRef] [Google Scholar] 25.Хиггс Б.В., Лю З., Уайт Б. и др. . У пациентов с системной красной волчанкой, миозитом, ревматоидным артритом и склеродермией наблюдается активация общего пути интерферона I типа. Энн Реум Дис 2011;70:2029–36. 10.1136/издание 2011.150326 [PubMed] [CrossRef] [Google Scholar] 27. Lood C, Blanco LP, Purmalek MM, et al. . Нейтрофильные внеклеточные ловушки, обогащенные окисленной митохондриальной ДНК, являются интерферогенными и способствуют развитию волчаночноподобного заболевания. Нат Мед 2016;22:146–53. 10.1038/нм.4027 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]28.Гарсия-Ромо Г.С., Кайелли С., Вега Б. и др. . Сетчатые нейтрофилы являются основными индукторами продукции IFN I типа при системной красной волчанке у детей. Sci Transl Med 2011;3 10.1126/научн.мед.3001201 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]29. Ланде Р., Гангули Д., Факкинетти В. и др. . Нейтрофилы активируют плазмоцитоидные дендритные клетки, высвобождая комплексы собственная ДНК-пептид при системной красной волчанке. Sci Transl Med 2011;3 10.1126/научн.мед.3001180 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]30.Yao Y, Higgs BW, Morehouse C, et al. . Разработка потенциальных фармакодинамических и диагностических маркеров для испытаний моноклональных антител против IFN-α при системной красной волчанке. Hum Геномика Протеомика 2009;1 10.4061/2009/374312. [Epub перед печатью: 17 ноября 2009 г.]. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]31. Ли Л., Ся И., Чен С. и др. . Соотношение нейтрофилов и лимфоцитов при системной красной волчанке: ретроспективное исследование. Int J Clin Exp Med 2015;8:11026–31. [Бесплатная статья PMC] [PubMed] [Google Scholar]33.Kuijpers TW, Tool AT, van der Schoot CE, et al. . Экспрессия мембранного поверхностного антигена на нейтрофилах: переоценка использования поверхностных маркеров для активации нейтрофилов. Кровь 1991;78:1105–11. [PubMed] [Google Scholar] 34. Кондамин Т., Домингес Г.А., Юн Дж.И. и др. . Окисленный рецептор ЛПНП-1 лектинового типа отличает популяцию человеческих полиморфноядерных миелоидных супрессорных клеток у больных раком. Научный Иммунол 2016;1:aaf8943–aaf43. 10.1126/sciimmunol.aaf8943 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]35.Хок Б.Д., Тейлор К.Г., Кросс Н.Б. и др. . Влияние активированных полиморфноядерных лейкоцитов человека на пролиферацию и жизнеспособность Т-лимфоцитов. Иммунология 2012; 137: 249–58. 10.1111/имм.12004 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]37. Савамура Т., Куме Н., Аояма Т. и др. . Эндотелиальный рецептор окисленного липопротеина низкой плотности. Природа 1997; 386: 73–7. 10.1038/386073а0 [PubMed] [CrossRef] [Google Scholar] 38. Тайе А, Эль-Шейх ААК. Пути лектиноподобного окисленного рецептора липопротеинов низкой плотности 1.Евро Джей Клин Инвест 2013;43:740–5. 10.1111/eci.12092 [PubMed] [CrossRef] [Google Scholar]40. Обермайер Г., Афонюшкин Т., Биндер С.Дж. Окисленный липопротеин низкой плотности при воспалительном тромбозе. Джей Тромб Хемост 2018;16:418–28. 10.1111/jth.13925 [PubMed] [CrossRef] [Google Scholar]41. Хайем Г., Никез-Роланд П., Палаццо Э. и др. . Антиоксидантные антитела к липопротеинам низкой плотности (окЛПНП) при системной красной волчанке с антифосфолипидным синдромом и без него. волчанка 2001; 10: 346–51. 10.1191/096120301667475689 [PubMed] [CrossRef] [Google Scholar]42. Лопес Л.Р., Салазар-Парамо М., Палафокс-Санчес С. и др. . Окисленный липопротеин низкой плотности и бета2-гликопротеин I у пациентов с системной красной волчанкой и увеличенной толщиной комплекса интима-медиа сонных артерий: значение при аутоиммунно-опосредованном атеросклерозе. волчанка 2006; 15:80–86. 10.1191/0961203306lu2267oa [PubMed] [CrossRef] [Google Scholar]43. Маэба Р., Маруяма А., Тарутани О. и др. . Окисленный липопротеин низкой плотности индуцирует продукцию супероксида нейтрофилами.FEBS Lett 1995; 377: 309–12. 10.1016/0014-5793(95)01336-9 [PubMed] [CrossRef] [Google Scholar]44. Sedgwick JB, Hwang YS, Gerbyshak HA, et al. . Окисленный липопротеин низкой плотности активирует миграцию и дегрануляцию гранулоцитов человека. Am J Respir Cell Мол Биол 2003; 29: 702–9. 10.1165/rcmb.2002-0257OC [PubMed] [CrossRef] [Google Scholar]46. Мундер М., Моллинедо Ф., Калафат Дж. и др. . Аргиназа I конститутивно экспрессируется в гранулоцитах человека и участвует в фунгицидной активности. Кровь 2005; 105: 2549–56.10.1182/кровь-2004-07-2521 [PubMed] [CrossRef] [Google Scholar]47. Мундер М., Шнайдер Х., Лукнер С. и др. . Подавление функций Т-клеток аргиназой гранулоцитов человека. Кровь 2006; 108:1627–34. 10.1182/кровь-2006-11-010389 [PubMed] [CrossRef] [Google Scholar]48. Пиллэй Дж., Так Т., Камп В.М. и др. . Иммунная супрессия нейтрофилами и клетками-супрессорами гранулоцитарного миелоидного происхождения: сходства и различия. Cell Mol Life Sci 2013;70:3813–27. 10.1007/s00018-013-1286-4 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]49.Хуан Л.В., Чанг К.Л., Чен С.Дж. и др. . Уровни аргиназы повышены у пациентов с ревматоидным артритом. Гаосюн J Med Sci 2001; 17: 358–63. [PubMed] [Google Scholar]50. Полат М.Ф., Тайси С., Полат С. и др. . Повышенный уровень активности аргиназы в сыворотке крови у больных раком молочной железы. Surg сегодня 2003; 33: 655–61. 10.1007/s00595-002-2563-2 [PubMed] [CrossRef] [Google Scholar]51. Cloke TE, Garvey L, Choi BS, et al. . Повышенный уровень активности аргиназы коррелирует с тяжестью заболевания у ВИЧ-серопозитивных пациентов.J заразить Dis 2010; 202: 374–85. 10.1086/653736 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]52. Ли Ю.Н., Ху Ф.Л., Дай Ю.Дж. и др. . Сывороточный антилипокалин 2 IgG является новым биомаркером в диагностике системной красной волчанки. волчанка 2014; 23:868–75. 10.1177/0961203314530484 [PubMed] [CrossRef] [Google Scholar]53. Ле НТВ, Ричардсон Д.Р. Хелаторы железа с высокой антипролиферативной активностью усиливают экспрессию гена, ингибирующего рост и подавляющего метастазирование: связь между метаболизмом железа и пролиферацией.Кровь 2004; 104: 2967–75. 10.1182/кровь-2004-05-1866 [PubMed] [CrossRef] [Google Scholar]54. Ум В.С., На К., Сонг Г.В. и др. . Цитокиновый баланс в ткани почек больных волчаночным нефритом. Ревматология 2003;42:935–8. 10.1093/ревматология/кег255 [PubMed] [CrossRef] [Google Scholar]55. Масутани К., Акахоши М., Цуруя К. и др. . Преобладание иммунного ответа Th2 при диффузном пролиферативном волчаночном нефрите. Артрит Реум 2001;44:2097–106. 10.1002/1529-0131(200109)44:9<2097::AID-ART360>3.0.СО;2-6 [PubMed] [CrossRef] [Google Scholar]56. Кикавада Э., Ленда Д.М., Келли В.Р. Дефицит IL-12 у мышей MRL-Fas(lpr) задерживает нефрит и внутрипочечную экспрессию IFN-gamma, а также уменьшает системную патологию. Дж Иммунол 2003; 170:3915–25. 10.4049/иммунол.170.7.3915 [PubMed] [CrossRef] [Google Scholar]

    Frontiers | Гранулоциты низкой плотности являются новым иммунопатологическим признаком как при рассеянном склерозе, так и при нейромиелите зрительного нерва

    Введение

    Гранулоциты низкой плотности (LDG) представляют собой нейтрофильные гранулоциты, которые остаются во фракции мононуклеарных клеток периферической крови (PBMC) после разделения в градиенте плотности.При первом описании было отмечено, что они являются признаком ревматологических заболеваний, таких как системная красная волчанка (СКВ) (1), в то время как в более поздних работах описывались ЛДГ при различных состояниях, таких как астма (2), туберкулез (3) и псориаз. 4). ЛДГ участвуют в патогенезе СКВ, продуцируя интерфероны типа I и подвергаясь спонтанному НЕТозу (образованию нейтрофильных внеклеточных ловушек), таким образом обеспечивая потенциально иммуногенное ядерное вещество (5, 6). Их роль в патогенезе других заболеваний менее ясна.

    Происхождение ЛДГ еще не выяснено, и предполагается, что они представляют собой незрелые или дегранулированные нейтрофилы. Интересно, что ЛДГ при СКВ демонстрируют незрелую ядерную структуру, хотя они экспрессируют поверхностные маркеры зрелых гранулоцитов, такие как CD16 (5, 6).

    Расстройство спектра нейромиелита оптика (NMOSD) и рассеянный склероз (MS) являются нейровоспалительными состояниями неизвестной этиологии. Доказательств участия гранулоцитов в патогенезе РС до сих пор мало, в то время как некоторые ранние исследования указывают на роль нейтрофилов в патогенезе NMOSD (7, 8).

    В этом исследовании мы предоставляем первые доказательства существования LDGs в MS и NMOSD и, таким образом, добавляем еще один кусочек головоломки к роли врожденной иммунной системы в патогенезе этих заболеваний.

    Материалы и методы

    пациента с СКВ были набраны из ревматологических амбулаторных отделений Charité Universitätsmedizin Berlin. Данные о пациентах с РС и NMOSD были получены из продолжающихся обсервационных исследований в Центре клинических исследований NeuroCure, Charité — Universitätsmedizin Berlin без предварительного отбора по полу, возрасту или другим клиническим параметрам.Эти исследования были одобрены комитетом по этике Charité — Universitätsmedizin Berlin (MS: EA1/163/12; NMOSD: EA1/041/14) и проводились в соответствии с Хельсинкской декларацией 1964 г. в ее действующей версии. От всех участников исследования было получено письменное информированное согласие.

    РС-диагноз ставили в соответствии с пересмотренными критериями McDonald 2010 г. (9), NMOSD-диагноз устанавливали в соответствии с международными консенсусными диагностическими критериями NMOSD 2015 г. (10). Все пациенты с СКВ соответствовали критериям классификации ACR 1997 года (11).

    У всех пациентов с РС и NMOSD была стабильная фаза заболевания с минимум 3 месяцами с момента последнего рецидива и последней импульсной терапии глюкокортикоидами. Мы исключили пациентов, если у них были дополнительные аутоиммунные, инфекционные или злокачественные заболевания. Мы сопоставили процент ЛДГ с клинической информацией, такой как оценка по расширенной шкале статуса инвалидности (EDSS), число рецидивов, лечение и продолжительность заболевания, а также титры анти-MOG (миелиновый олигодендроцитный гликопротеин) и анти-AQP-4 (аквапорин). -4) антитела.

    Выделение, окрашивание и проточная цитометрия РВМС

    Мы выделили слой РВМС с разделением по градиенту плотности 10 мл крови, обработанной гепарином и антикоагулянтом, с использованием градиента Ficoll-Paque PLUS (GE Healthcare). PBMC однократно промывали в фосфатно-солевом буфере (PBS) с добавлением 3% бычьего сывороточного альбумина (BSA) и затем окрашивали следующими конъюгатами антител: CD45 FITC (Miltenyi Biotec, кат. № 130-080-202, RRID: AB_244234), CD14 Cy5 (DRFZ, клон TM1), CD15 PE-Cy7 (BioLegend, кат. № 323029, RRID: AB_2561669), CD16 PE (BioLegend, кат. № 302008, RRID: AB_314208), CD14 APC-Cy7 (BioLegend, кат. № 367108, RRID: AB_2566710 ) и CD11c Pacific Blue (BioLegend Cat# 337212, RRID: AB_1595430).Мы получили образец с помощью цитометра FACSCanto (BD Biosciences) или MACSQuant (Miltenyi). Для визуализации проточной цитометрии (Amnis) мы выделяли и окрашивали клетки, как описано выше, фиксировали образец с помощью набора буферов для окрашивания Foxp3 / фактора транскрипции (eBioscience) и получали клетки на Amnis ImageStream X Mark II. Все эксперименты по цитометрии проводились в соответствии с «Руководством по использованию проточной цитометрии и сортировки клеток в иммунологических исследованиях» (12).

    Анализ данных FACS

    Мы исключили субклеточный детрит и дублеты на основе характеристик рассеяния и гейтирования по лейкоцитам CD45 + .Из них мы определили ЛДГ как CD14 CD15 высокий и рассчитали соотношение ЛДГ всех CD45 + РВМС (рис. 1А). Затем мы определили долю CD16 high LDG. Анализ данных FACS проводили с использованием FlowJo Version 10.4.1 (FlowJo LLC). Мы проанализировали данные ImageStream с помощью IDEAS версии 6.2 (Amnis).

    Рисунок 1. (A) LDG (CD14 CD15 high ) являются признаками NMOSD и MS, но не HD (HD: n = 23, NMOSD: n = 20, MS5 n 9092 = 17 СКВ: n = 15).Столбцы показывают медиану и 95% доверительные интервалы. Горизонтальная полоса указывает 0,7%, отсечку, которая отделяет все HD от образцов 17/20 NMOSD, 11/17 MS, а также 13/15 SLE. Критерий Крускала-Уоллиса с поправкой Данна для множественного тестирования ** p < 0,005 и **** p < 0,0001. (B) Большинство LDG являются CD16 high , но при NMOSD и MS больше CD16 high LDG, чем при HD. Есть некоторые выбросы с очень низким уровнем CD16 и высоким LDG.Столбцы показывают медиану и 95% доверительные интервалы. Критерий Краскела-Уоллиса с поправкой Данна для множественного тестирования (HD: n = 23, NMOSD: n = 20, MS: n = 16 SLE: n = 15), тест, * p < 0,05 и *** р < 0,001. (C) LDG представляют собой CD11b+ [Gated на CD14-CD15+, серый: флуоресценция минус один (FMO) контроль].

    Статистический анализ

    Процент LDG различных болезненных состояний и процент CD16 high LDG сравнивали с HD с использованием теста Крускала-Уоллиса с поправкой Данна для множественного тестирования.Для различия между двумя группами мы использовали критерий Манна-Уитни. Весь статистический анализ был выполнен в GraphPad Prism Version 7.0e для Mac OS X (программное обеспечение GraphPad).

    Результаты

    ЛДГ характерны для многих воспалительных состояний и имеют неизвестное патогенное значение. Чтобы выяснить, существуют ли LDG также при NMOSD и MS, мы провели анализ FACS 76 образцов периферической крови.

    Описание когорты

    Мы провели анализ 17 пациентов с рассеянным склерозом, а также 20 пациентов с NMOSD, из которых 8 были положительными по анти-AQP4 и 4 положительными по антителам против MOG.Контролем служили 15 пациентов с СКВ и 23 ГБ. Медиана баллов по шкале EDSS составила 4,0 в группе с рассеянным склерозом и 3,0 в группе с NMOSD. Наиболее распространенными методами лечения в группе РС были диметилфумарат (6/17) и бета-интерферон (4/17). Среднее число рецидивов у пациентов с ремиттирующим течением РС (RRMS) составило 2,5. Пациенты с NMOSD чаще всего получали ритуксимаб (8/20), микофенолат (4/20) и азатиоприн (4/20) (табл. 1).

    Таблица 1 . Эпидемиологическая информация об исследуемой популяции.

    Гранулоциты низкой плотности являются признаком как рассеянного склероза, так и оптиконейромиелита

    По сравнению со здоровыми людьми, как у пациентов с РС, так и у пациентов с НМО значительно выше процент ЛДГ. Образцы SLE показали самые высокие частоты LDG (MS: 0,9%, NMO 2,1%, SLE: 4,3%, HD: 0,2%, средняя доля CD45 + клеток) (рис. 1A). Ни один из HDs, но образцы 17/20 NMOSD и 11/17 MS, а также образцы SLE 13/15 не имели не менее 0,7% LDG. Доля CD16 high LDG различалась как между группами, так и внутри них (рис. 1B), но была значительно выше при NMOSD и MS по сравнению с HCs.LDG равномерно экспрессировали CD11b (рис. 1C).

    LDG демонстрируют гетерогенную ядерную морфологию

    Мы проанализировали ядерную морфологию ЛДГ у пациентов с NMOSD, MS и SLE. В то время как некоторые из клеток CD14 , CD15 high демонстрировали сегментированную форму ядра, типичную для зрелых гранулоцитов, другие имели лентовидные или округлые ядра, которые традиционно считались незрелыми формами (рис. 2).

    Рисунок 2 . Визуализирующий проточный цитометрический анализ LDG от здорового донора и пациентов с СКВ, РС и NMOSD выявил LDG с гетерогенной формой ядра, от круглой до многосегментной.

    Нелеченные пациенты с НССН показывают более высокие фракции ЛДГ

    Мы искали ассоциации между долей LDG у пациентов с РС и NMOSD и их клиническими характеристиками, такими как время с момента первого проявления заболевания, количество рецидивов, тяжесть инвалидности, судя по шкале EDSS, тип лечения и статус антител, но значимых корреляций не обнаружено (данные не показаны). Пациенты с NMOSD, которые не получали непрерывного иммуносупрессивного лечения, имели значительно более высокий процент LDG по сравнению с их сверстниками, получавшими лечение (медиана LDG, получавших лечение 1.4%, необработанные 7,9%, p < 0,01). Процент фракции ЛДГ не коррелировал с клинической тяжестью, количеством рецидивов или статусом антител.

    Обсуждение

    Это исследование демонстрирует наличие гранулоцитов низкой плотности при РС и НМОСД.

    В отличие от рассеянного склероза, при NMOSD считается, что классические гранулоциты играют ключевую роль, поскольку они могут быть обнаружены в биоптатах тканей (7) и описаны изменения в функции нейтрофилов (8). Недавно мы описали лейкоциты CD11b+ в РВМС больных РС, которые характеризовались повышенной активацией НАД(Ф)Н-оксидазы (NOX) (13).В них активация NOX коррелировала с клинической активностью. Хотя в то время мы предполагали, что эти клетки являются моноцитами, присутствие ЛДГ во фракции мононуклеарных клеток периферической крови (РВМС) может служить альтернативным объяснением наших предыдущих результатов.

    Мы обнаружили, что фракция LDG у пациентов с NMOSD и MS содержит значительно больше клеток CD16 high , что является маркером, указывающим на зрелость нейтрофилов. Как описано ранее для ЛДГ при СКВ, ядра ЛДГ при NMOSD различаются между зрелыми сегментированными и незрелыми округлыми формами.В предыдущих исследованиях незрелая морфология ядра была связана с экспрессией поверхностных маркеров, характерных для зрелых клеток, что позволяет предположить, что LDGs не вписываются в традиционный спектр зрелости гранулоцитов (6).

    Эта работа добавляет MS и NMOSD к разнообразному списку воспалительных состояний с участием LDG. На наш взгляд, это делает более вероятным, что ЛДГ являются эпифеноменом продолжающегося воспаления, а не причинной частью патогенеза конкретного заболевания, но необходимы дальнейшие исследования для установления роли этих клеток в различных состояниях.Интересно, что у пациентов с NMOSD часто наблюдаются дополнительные иммуноопосредованные расстройства, особенно СКВ (14). Тот факт, что оба этих расстройства демонстрируют высокие доли ЛДГ, также может указывать на общие патогенетические механизмы. В недавнем исследовании сообщалось о сильной корреляции ЛДГ и использования глюкокортикоидов в больших наборах транскрипционных данных пациентов с СКВ (15). Это противоречит нашим результатам, поскольку ни один из пациентов с РС и НМОСД не получал системного лечения глюкокортикоидами за последние 3 месяца.

    Чтобы установить потенциал ЛДГ в качестве биомаркера при нейровоспалительных заболеваниях или воспалении в целом, следует провести анализ более крупных и продольных когорт, чтобы выявить потенциальные корреляции с тяжестью заболевания или прогнозом.

    Заявление о доступности данных

    Наборы данных, созданные для этого исследования, могут быть получены от соответствующего автора по обоснованному запросу.

    Заявление об этике

    Исследования с участием людей были рассмотрены и одобрены Этиккомиссией, Charité – Universitätsmedizin Berlin. Пациенты/участники предоставили письменное информированное согласие на участие в этом исследовании.

    Вклад авторов

    LO, RM, RN, AH и HR спланировали исследование и разработали эксперименты.LO, SK и RL проводили эксперименты. JB-S, SA, KR, TA и FP заботились о пациентах и ​​предоставляли клиническую информацию. LO провел статистический анализ и написал рукопись. HR контролировал работу. Все авторы внесли свой вклад в рукопись и одобрили окончательный вариант.

    Финансирование

    Эта работа была поддержана DFG TRR130, TPC01 (до RN и AH), TP17 (до AH и HR) и Кампусом хронического воспаления им. Лейбница. LO был членом Высшей школы хронического воспаления Лейбница.

    Конфликт интересов

    KR получил исследовательскую поддержку от Novartis, Merck Serono и Министерства образования и исследований Германии, а также гонорары за выступления и гранты на поездки от Bayer Healthcare, Biogen Idec, Merck Serono, санофи-авентис/Genzyme, Teva Pharmaceuticals, Roche, Novartis и Благотворительный фонд Гати Джексона. FP работал в научных консультативных советах Novartis и MedImmune; получил финансирование поездки и/или гонорары спикеров от Bayer, Novartis, Biogen, Teva, Sanofi-Aventis/Genzyme, Merck Serono, Alexion, Chugai, MedImmune и Shire; младший редактор журнала Неврология: нейроиммунология и нейровоспаление ; академический редактор PLoS ONE ; консультировал Sanofi Genzyme, Biogen, MedImmune, Shire и Alexion; получил исследовательскую поддержку от Bayer, Novartis, Biogen, Teva, Sanofi-Aventis/Geynzme, Alexion и Merck Serono; и получил исследовательскую поддержку от Немецкого исследовательского совета, Werth Stiftung города Кельна, Министерства образования и исследований Германии, Arthur Arnstein Stiftung Berlin, Рамочной программы ЕС FP7, Фонда Артура Арнштейна в Берлине, Благотворительного фонда Гути-Джексона и NMSS.HR получил гонорары спикеров и поддержку исследований от Novartis и Sanofi-Aventis/Genzyme, не связанных с этим проектом.

    Остальные авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Мы благодарим Пегги Мекс (DRFZ) за техническую помощь. Мы в долгу перед нашими пациентами и здоровыми людьми за их донорство крови. Мы признательны за поддержку со стороны Немецкого исследовательского фонда (DFG) и Фонда публикаций открытого доступа Charité — Universitätsmedizin Berlin.Препринт этой рукописи доступен на сайте bioRxiv (16).

    Ссылки

    1. Hacbarth E, Kajdacsy-Balla A. Нейтрофилы низкой плотности у больных системной красной волчанкой, ревматоидным артритом и острой ревматической лихорадкой. Ревматоидный артрит . (1986) 29:1334–42. дои: 10.1002/арт.17802

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    2. Фу Дж., Тобин М.С., Томас Л.Л. Нейтрофилоподобные гранулоциты низкой плотности повышены у пациентов с персистирующей астмой средней и тяжелой степени. Энн Аллергия Астма Иммунол. (2014) 113:635–40.e2. doi: 10.1016/j.anai.2014.08.024

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    3. Дэн Й, Йе Дж, Луо Кью, Хуанг Зи, Пэн Й, Сюн Г и др. Гранулоциты низкой плотности повышены при микобактериальной инфекции и связаны с тяжестью туберкулеза. ПЛОС ОДИН . (2016) 11:e0153567. doi: 10.1371/journal.pone.0153567

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    4.Лин А.М., Рубин С.Дж., Кхандпур Р., Ван Дж.И., Риблетт М., Ялаварти С. и др. Тучные клетки и нейтрофилы высвобождают IL-17 посредством образования внеклеточных ловушек при псориазе. Дж Иммунол. (2011) 187:490–500. doi: 10.4049/jimmunol.1100123

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    5. Кармона-Ривера С., Каплан М.Дж. Гранулоциты низкой плотности: особый класс нейтрофилов при системном аутоиммунитете. Семин Иммунопатол. (2013) 35:455–63. doi: 10.1007/s00281-013-0375-7

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    6.Денни М.Ф., Ялаварти С., Чжао В., Такер С.Г., Андерсон М., Сэнди А.Р. и др. Отдельная подгруппа провоспалительных нейтрофилов, выделенных у пациентов с системной красной волчанкой, вызывает повреждение сосудов и синтезирует интерфероны I типа. Дж Иммунол. (2010) 184:3284–97. doi: 10.4049/jimmunol.0

    9

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    8. Hertwig L, Pache F, Romero-Suarez S, Stürner KH, Borisow N, Behrens J, et al. Различная функциональность нейтрофилов при рассеянном склерозе и оптикомиелите. Мульт Склер J . (2016) 22:160–73. дои: 10.1177/1352458515586084

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    9. Polman CH, Reingold SC, Banwell B, Clanet M, Cohen JA, Filippi M, et al. Диагностические критерии рассеянного склероза: пересмотренные в 2010 г. критерии Макдональдса. Энн Нейрол. (2011) 69: 292–302. doi: 10.1002/ana.22366

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    10. Wingerchuk DM, Banwell B, Bennett JL, Cabre P, Carroll W, Chitnis T, et al.Международные согласованные диагностические критерии расстройств спектра оптиконевромиелита. Неврология . (2015) 85:177–89. doi: 10.1212/WNL.0000000000001729

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    11. Хохберг М.С. Обновление Американского колледжа ревматологов пересмотрело критерии классификации системной красной волчанки. Ревматоидный артрит . (1997) 40:1725. дои: 10.1002/арт.1780400928

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    12.Коссарица А., Чанг Х.Д., Радбрух А., Акдис М., Андре И., Аннунциато Ф. и др. Руководство по использованию проточной цитометрии и сортировки клеток в иммунологических исследованиях. Евро J Иммунол. (2017) 47:1584–797. дои: 10.1002/eji.201646632

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    13. Mossakowski AA, Pohlan J, Bremer D, Lindquist R, Millward JM, Bock M, et al. Отслеживание ЦНС и системных источников окислительного стресса при хроническом нейровоспалении. Acta Neuropathol . (2015) 130:799–814. doi: 10.1007/s00401-015-1497-x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    14. Джариус С., Рупрехт К., Вильдеманн Б., Кемпфель Т., Рингельштейн М., Гейс С. и соавт. Сравнение паттернов заболевания при серопозитивном и серонегативном оптикомиелите: многоцентровое исследование 175 пациентов. Дж Нейровоспаление. (2012) 9:14. дои: 10.1186/1742-2094-9-14

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    15.Кегеррайс Б.Дж., Каталина М.Д., Герачи Н.С., Бачали П., Липски П.Е., Грэммер А.С. Геномная идентификация гранулоцитов низкой плотности и анализ их роли в патогенезе системной красной волчанки. Дж Иммунол . (2019) 202:3309–17. doi: 10.4049/jimmunol.1801512

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    16. Ostendorf P, Mothes P, van Koppen S, Lindquist PL, Bellmann-Strobl J, Asseyer S, et al. Гранулоциты низкой плотности являются новым иммунопатологическим признаком как рассеянного склероза, так и расстройства спектра оптиконейромиелита. биоРксив . дои: 10.1101/668160v1

    Полнотекстовая перекрестная ссылка | Академия Google

    Патогены | Бесплатный полнотекстовый | Загадка гранулоцитов низкой плотности у человека: сложности в характеристике и функции LDG во время болезни

    LDG и gMDSC являются хорошо известными типами клеток, обнаруженными в большом количестве при раке, обычно в опухолях, хотя некоторые источники описывают моноцитарные MDSC как более распространенные. внутри опухолей [81]. Повышенные уровни MDSC в сочетании с опухолями коррелируют с более высокими показателями смертности пациентов [82].У пациентов с немелкоклеточным раком легкого уровень gMDSCs был повышен в образцах опухоли легкого, и эти уровни повышались еще больше по мере прогрессирования тяжести заболевания от стадии I к стадии III [27]. Пациенты с плоскоклеточным раком гортани/ротоглотки (рак головы и шеи) имели значительно повышенный уровень gMDSCs в опухолях по сравнению со здоровыми донорами, и это повышенное состояние коррелировало с ухудшением исхода [26]. Высокие уровни gMDSC (и моноцитарных MDSC) также коррелировали с более высокой смертностью у пациентов с метастатическим колоректальным раком [83].Таким образом, общий консенсус, который в настоящее время теоретизируется в области рака, заключается в том, что повышенное присутствие LDG и gMDSC приводит к плохому исходу в отношении выживаемости пациентов или ремиссии. LDG обычно характеризуются их способностью подавлять функцию Т-клеток при раке. Тем не менее, некоторые исследования выявляют больных раком с gMDSCs, которые не могут ограничить пролиферацию Т-клеток. Альфаро и др. продемонстрировали, что gMDSC от пациентов с распространенным раком легкого и простаты не снижают пролиферацию Т-клеток [25].Интересно, что в этом исследовании было обнаружено, что моноцитарные MDSC подавляют пролиферацию Т-клеток. Кроме того, gMDSC больных раком продуцируют внеклеточные ловушки при воздействии липополисахарида или IL-8, как и NDN здоровых пациентов [25]. Являются ли эти данные показателем того, что эти клетки, возможно, не являются истинными MDSC? Более строгие стандарты классификации могли бы помочь прояснить эти расхождения в идентичности по мере их появления, особенно когда клетки доступны в крови (по сравнению с тканями) для дополнительного изучения.Одним из основных элементов, широко исследуемых у онкологических больных, являются терапевтические средства, нацеленные на популяции ЛДГ. Фармацевтические препараты, в том числе маравирок, гемцитабин, цисплатин, тадалафил, энтиностат и доцетаксел, широко изучались как на мышах, так и в клинических испытаниях на людях с некоторым успехом [84]. Было показано, что тасквинимод, антиангиогенный химиотерапевтический препарат, снижает рост опухоли рака предстательной железы человека на 50% по сравнению с контролем в модели ксенотрансплантата на мышах [85]. Было показано, что этот химиотерапевтический препарат непосредственно нацелен на популяции MDSC в моделях рака простаты у мышей, хотя клинические испытания все еще находятся на ранних стадиях для определения того, может ли тасквинимод работать в качестве супрессора MDSCs у больных раком [86,87].Сунитиниб, ингибитор рецепторной тирозинкиназы, который блокирует рецептор фактора роста тромбоцитов (PDGF-R), рецептор колониестимулирующего фактора-1 (CSF-1) и рецептор фактора роста эндотелия сосудов (VEGF-R), использовался в пациентов с почечно-клеточным раком [88]. Вскоре после его появления в качестве противоракового средства исследования показали, что уровни gMDSCs снижались у пациентов после 1-2 циклов лечения [89]. Однако в исследовании на мышах эффектов сунитиниба при раке предстательной железы Fu et al.неожиданно было обнаружено, что лечение сунитинибом фактически увеличивало количество gMDSCs в периферической крови мышей с небольшим эффектом на привлечение gMDSCs к опухолевым клеткам [90]. Хотя эти несоответствия удивительны, различия в терапевтических результатах между людьми и мышами не беспрецедентны [91,92,93]; таким образом, могут быть ключевые элементы исследований на мышах, которые невозможно перевести. Интерес к белку запрограммированной клеточной гибели 1 (PD-1) и его лиганду (PD-L1) на поверхности gMDSCs также значительно вырос за последние годы в качестве терапевтических мишеней [94].В одном исследовании с использованием gMDSC от пациентов с немелкоклеточным раком легкого Kim et al. обнаружили, что у пациентов, которые не ответили на анти-PD-1-терапию (с использованием ниволумаба), было увеличено большее количество gMDSC-ассоциированных хемокинов (включая CXCL2, CCL23 и CX3CL1) по сравнению с пациентами, которые ответили на лечение [95]. . Соответственно, у пациентов, которые ответили на ниволумаб, как правило, было меньшее количество gMDSC; неожиданно, этот ответ на ниволумаб также проявлял тенденцию к увеличению числа регуляторных Т-клеток (T reg ) в периферической крови.Обратная корреляция между клетками T reg и gMDSC наблюдалась в когорте, реагирующей на лечение [95]. Рассчитанное отношение T regs к gMDSC предсказывало ответ на лечение, когда оно превышало пороговое значение 0,39 [95]. Действительно, лучший прогноз у пациентов с немелкоклеточным раком легкого, получающих анти-PD-1 терапию (через пембролизумаб или ниволумаб), коррелирует с более низкими уровнями gMDSC (и моноцитарных MDSC и CD39 + CD8 + Т-клеток) [96]. ].Хотя в этом разделе дается краткий обзор ЛДГ при раке и некоторых терапевтических достижений в этой области, которые потенциально могут быть применены к исследованиям инфекций, предстоит провести еще много дополнительных исследований. Большинство этих исследований описывают LDG как gMDSC, что, по-видимому, является общим консенсусом в области рака, за исключением нескольких исследований, использующих номенклатуру LDN (таблица 1). Это подтверждает вопрос в области рака: все ли gMDSC от онкологических больных эквивалентны LDG, или существует достаточная гетерогенность, чтобы существовали обе популяции с различными фенотипическими и функциональными характеристиками? Мы предполагаем необходимость исследований, основанных на секвенировании отдельных клеток, которые сочетаются с функциональными анализами с использованием фракций гранулоцитов клеток низкой плотности от онкологических больных, чтобы лучше различать различия между gMDSC и LDG в этой области.

    Гранулоциты низкой плотности пуповинной крови соответствуют подмножеству незрелых гранулоцитов с низкой экспрессией S100A12

    Введение

    Несмотря на значительный прогресс медицины в предыдущие десятилетия, инфекции и сепсис остаются основной причиной смерти в неонатальный период (1). Когда человеческая жизнь впервые знакомится с окружающей средой, она выходит из почти стерильного окружения. В этой ситуации жизненно важное значение имеет развитие сбалансированного иммунного ответа с эффективным контролем патогенов и одновременной толерантностью к полезной микробиоте.Поскольку адаптивная иммунная система не полностью развита при рождении, новорожденные в основном зависят от своего врожденного иммунного ответа. Нейтрофильные гранулоциты представляют собой основной клеточный компонент врожденной иммунной системы, и их адекватная функциональность является ключом к сбалансированному иммунитету. Было описано несколько нарушений неонатальных нейтрофилов (2–4), которые частично объясняют особую уязвимость новорожденных к инфекциям. Напротив, это физиологическое иммунодефицитное состояние может быть необходимо для предотвращения подавляющего послеродового иммунного ответа.Поэтому представляет особый интерес дальнейшее изучение фенотипа и функций нейтрофилов в неонатальном периоде.

    Долгое время считалось, что нейтрофилы представляют собой однородную популяцию короткоживущих лейкоцитов, создающих раннюю линию широкой неспецифической защиты от вторжения патогенов. Хотя субпопуляция гранулоцитов низкой плотности (ЛДГ) была впервые описана еще в 1986 г. у больных системной красной волчанкой, ревматоидным артритом и острой ревматической лихорадкой (5), сложная гетерогенность нейтрофилов до сих пор остается предметом дискуссий.LDG определяются как гранулоцитарные клетки, которые появляются в слое PBMC во время центрифугирования в градиенте плотности. Совсем недавно они были обнаружены при других аутоиммунных состояниях (6–8), у онкологических больных (9), ВИЧ-инфекции (10), сепсисе (11) и физиологически у новорожденных, а также у беременных женщин (12, 13). Следует отметить, что LDG представляют собой гетерогенную популяцию (14) и, вероятно, возникают из-за различных (пато-) механизмов. Было описано, что при аутоиммунных заболеваниях (15), туберкулезе (16) и малярии (17) ЛДГ играет провоспалительную роль, тогда как у онкологических больных ВИЧ-инфекция и исследования новорожденных указывают на противоположное направление (9, 10, 12).Противоречивые результаты были получены в отношении иммунодепрессивных функций ЛДГ (17, 18). Рибер и др. (12) предложили супрессорный эффект на пролиферацию Т-клеток и, как следствие, назвали ЛДГ пуповинной крови (CB) гранулоцитарными миелоидными супрессорными клетками (GR-MDSC).

    В ответ на клеточный стресс фагоцитами и особенно гранулоциты как белок молекулярного паттерна, ассоциированный с повреждением (DAMP) (20).Помимо его роли в качестве DAMP, также были описаны антимикробные (21) и противопаразитарные (22) функции. Кроме того, S100A12 был признан маркером ювенильного идиопатического артрита (23) и предложен в качестве потенциального маркера неонатального сепсиса с ранним началом в амниотической жидкости (24). Недавно Тоссон и соавт. (25) может дополнительно идентифицировать S100A12 в сыворотке как возможный диагностический маркер неонатального сепсиса. Хотя было описано несколько внеклеточных функций (19, 26), его внутриклеточная роль и вклад в созревание нейтрофилов остаются неизвестными.Это представляет особый интерес, поскольку основным источником S100A12 являются нейтрофилы (27), и, насколько нам известно, не существует исследований по дифференциальной экспрессии в неонатальных подгруппах нейтрофилов.

    Таким образом, целью данного исследования было выявление специфических особенностей неонатальных нейтрофилов с акцентом на ЛДГ, их экспрессию S100A12 и их ранее описанные супрессивные эффекты.

    Материалы и методы

    Объекты исследования

    Исследование проводилось в Университетской клинике Мюнстера (Мюнстер, Германия).ЦБ анализировали у новорожденных доноров (90 005 n 90 006 = 136), контролем служила периферическая кровь взрослых здоровых лиц (90 005 n = 20). Все субъекты или их законные представители, включенные в это исследование, дали информированное письменное согласие в соответствии с Хельсинкской декларацией, и исследование было одобрено комитетом по этике Совета врачей Вестфалии-Липпе и Мюнстерского университета, Мюнстер, Германия (ссылка номера: 2017-024-фс и 2015-670-фс).

    Выделение клеток и сбор сыворотки

    Периферическую кровь и CB собирали в пробирки с ЭДТА и обрабатывали в течение 24 часов.Цельную кровь смешивали с раствором HetaSep (STEMCELL Technologies, Кельн, Германия) в соотношении 1:5 (HetaSep/цельная кровь) и инкубировали при 37°С. Через 30 мин верхний слой, богатый лейкоцитами, удаляли и промывали в 4-кратном объеме PBS (2% FCS и 1 мМ ЭДТА) путем центрифугирования при 200 × g в течение 10 мин. Промытые лейкоциты наслаивали на Ficoll-Paque (Biochrom, Кембридж, Великобритания) и центрифугировали в градиенте плотности при 500 × g в течение 30 минут, в результате чего получали слой РВМС и осадок гранулоцитов.Обе фракции клеток промывали в PBS (2% FCS и 1 мМ ЭДТА) и центрифугировали в течение 3 мин при 350 × g . LDG выделяли из PBMC, а гранулоциты нормальной плотности (NDG) дополнительно обогащали из осадка гранулоцитов с использованием набора для обогащения нейтрофилов человека EasySep (STEMCELL Technologies) в соответствии с инструкциями производителя. Полученные LDG (чистота > 75%) и NDG (чистота > 95%) кратковременно центрифугировали и ресуспендировали в среде RPMI 1640 (Biochrom). В некоторых экспериментах гранулоциты цельной крови (WBG) выделяли непосредственно из образцов крови с помощью набора для прямого выделения нейтрофилов человека EasySep (STEMCELL Technologies) в соответствии с инструкциями производителя.Из некоторых препаратов цитоспины готовили центрифугированием 1×10 5 клеток в PBS на предметном стекле при 30× g в течение 5 мин на приборе Shandon Cytospin 3 и сразу окрашивали по Паппенгейму с использованием растворов для окраски по Май–Грюнвальду и Гимзе. . Чтобы дополнительно охарактеризовать врожденные гранулоциты, аспираты костного мозга были получены в рамках рутинных диагностических процедур у пациентов с лейкемией в стадии ремиссии, чтобы их можно было рассматривать как нормальный контрольный аспират костного мозга, поскольку аспираты здорового костного мозга были недоступны.Образцы сыворотки центрифугировали при 1100 × g и хранили при –80°C до анализа.

    Количественная ПЦР в реальном времени

    Выделение РНК проводили с использованием набора NucleoSpin RNA II (Macherey-Nagel, Дюрен, Германия) в соответствии с инструкциями производителя. РНК (0,5 мкг) подвергали обратной транскрипции в кДНК с использованием обратной транскриптазы SuperScript II RNase H (Invitrogen, Carlsbad, CA) вместе с олиго 18 (dT) праймерами. Количественную ПЦР в реальном времени (qRT-PCR) проводили с помощью набора KAPA SYBR FAST qPCR Kit (Kapa Biosystems, Woburn, MA) на системе обнаружения ПЦР в реальном времени CFX384 Touch (Bio-Rad Laboratories, Мюнхен, Германия).Используемые праймеры: S100A12 прямой, 5′-CAA AAC TTG AAG AGC ATC TGG AGG-3′ и S100A12 обратный, 5′-TGT TTG CAA GCT CCT TTG TAA GC-3′; RPL вперед, 5′-AGG TAT GCT GCC CCA CAA AAC-3′ и RPL назад, 5′-TGT AGG CTT CAG ACG CAC GAC-3′; и GAPDH в прямом направлении, 5′-CAA ATT CCA TGG CAC CGT CA-3′ и GAPDH в обратном направлении, 5′-TCG CCC CAC TTG ATT TTG G-3′. Экспрессию гена нормализовали по эндогенным генам контроля домашнего хозяйства RPL и GAPDH, а относительную экспрессию S100A12 рассчитывали методом сравнительного порогового цикла.

    Анализ методом проточной цитометрии

    Для анализа методом проточной цитометрии 100 мкл цельной крови, 50 мкл аспирата костного мозга или 1 × 10 5 выделенных клеток окрашивали 1 мкг/мл каждого Ат в течение 30 мин при 4°C в темноте сразу после блокирования неспецифического связывания Fc-рецептора блокирующим раствором Human TruStain FcX (BioLegend, Сан-Диего, Калифорния) в течение 10 мин. В случае окрашивания цельной крови эритроциты впоследствии лизировали, а клетки в целом фиксировали (используя Fix/Lyse Solution; eBioscience, Сан-Диего, Калифорния) в течение 10 мин.Используемые антитела: CD66b (клон G10F5), CD16 (3G8), CD64 (10.1), CR1 (CD35, E11), CD10 (HI10a), CD3 (OKT3), CD14 (HCD14), CD19 (HIB19) и CD56 (HCD56). ) (все куплено у BioLegend). После промывания клеток дважды в 2 мл буфера FACS (PBS с 2% FCS, 2 мМ EDTA и 0,05% NaN 3 ) клетки либо непосредственно анализировали с помощью проточной цитометрии (FACS Canto Flow Cytometer; BD Biosciences, San Jose, CA) или окрашивали внутриклеточно на S100A12 (R&D Systems, Minneapolis, MN) с использованием набора для окрашивания Foxp3/Transcription Factor (eBioscience) в соответствии с инструкциями производителя.Для анализа гибели клеток мы использовали набор для обнаружения апоптоза FITC Annexin V с 7-аминоактиномицином D (BioLegend) в соответствии с протоколом производителя.

    Собранные данные были проанализированы с помощью программного обеспечения FlowJo (v10.0.8; FlowJo, Ashland, OR). Для оценки экспрессии белка рассчитывали среднюю интенсивность флуоресценции. Проточный цитометр ежедневно калибровали с использованием бусинок CS&T (BD Biosciences), и заданные значения фотоумножителя не менялись на протяжении всего исследования.

    Автоматический анализ крови

    Автоматический дифференциальный подсчет лейкоцитов был выполнен Институтом клинической химии и лабораторной медицины Мюнстера с использованием XN-3000 (Sysmex, Нордерштедт, Германия) в соответствии со стандартными клиническими процедурами.

    ELISA и измерения лактатдегидрогеназы

    Концентрации S100A12 в сыворотке и выделенных клеточных лизатах определяли с помощью системы ELISA, установленной в нашей лаборатории (28). Все образцы были разведены 1:10, 1:20 и 1:40, чтобы соответствовать линейным диапазонам анализов. Измерение проводили при возбуждении на длине волны 450 нм с коррекцией на длине волны 540 нм на планшет-ридере Infinite M200 (Tecan, Крайльсхайм, Германия).

    Функциональные свойства

    Фагоцитоз тестировали с использованием набора PHAGOTEXT (Glycotope Biotechnology, Гейдельберг, Германия) в соответствии с инструкциями производителя.Вкратце, два образца цельной крови инкубировали с меченными изотиоцианатом флуоресцеина бактериями Escherichia coli при 37°C, тогда как отрицательный контрольный образец оставался на льду. После добавления гасящего раствора и остановки реакции фагоцитоза интернализованные бактерии, меченные изотиоцианатом флуоресцеина, анализировали с помощью проточной цитометрии. Флуоресцентные микросферы (Fluoresbrite YG Carboxylate Microspheres; Polysciences, Hirschberg, Германия) диаметром 4,5 мкм использовали для проверки способности нейтрофилов фагоцитировать более крупные частицы.Для идентификации плазматической мембраны клетки окрашивали красителем CellMask Plasma Membrane Stain (Thermo Fisher Scientific).

    Для количественного определения NETosis 1 × 10 5 клеток высевали в каждую лунку микропланшета Black 96 (F-дно) в 160 мкл среды (RPMI 1640 и 1% FBS). Двадцать микролитров рабочего раствора SYTOX Green (Thermo Fisher Scientific) добавляли во все лунки до конечной концентрации 1,5 мкМ. Планшет предварительно инкубировали при 37°C в течение 15 минут, а затем клетки стимулировали 100 нг/мл LPS (LPS из Salmonella Minnesota R595; InvivoGen, Тулуза, Франция) и 100 нМ PMA (Merck, Дармштадт, Германия).Необработанные клетки служили отрицательным контролем. Клетки инкубировали при 37°C и 5% CO 2 и измеряли флуоресценцию ежечасно до 6 ч с настройкой фильтра 488/523 нм на планшет-ридере Infinite M200 (Tecan).

    Эксперименты по совместному культивированию

    Изолированные Т-клетки или РВМС метили CFSE (eBioscience, Франкфурт-на-Майне, Германия) в соответствии с протоколом производителя. Пролиферацию Т-клеток инициировали тремя различными способами. Для выделенных Т-клеток можно использовать либо CD3/CD28 Dynabeads (Thermo Fisher Scientific), либо 96-луночные планшеты, покрытые анти-человеческим CD3 (OKT3) (eBioscience) и 2 мкг/мл растворимого анти-CD28 (CD28.2) (eBioscience). PBMC стимулировали 100 ед/мл IL-2 (PeproTech, Гамбург, Германия) и 1 мкг/мл муромонаб-CD3 (OKT3) (eBioscience). Для анализа пролиферации Т-клеток к 100 000 Т-клеток добавляли 20 000–100 000 нейтрофилов. Для пролиферации РВМС в некоторых экспериментах LDG истощали с использованием гранул анти-CD66b (Miltenyi Biotec, Bergisch Gladbach, Germany) или добавляли 30000 выделенных LDG к 60000 PBMC на лунку. Среда для культивирования клеток представляла собой среду RPMI 1640 (Biochrom) с добавлением 10% термоинактивированной сыворотки человека, 2 мМ глутамина, 100 МЕ/мл пенициллина и 100 мг/мл стрептомицина.После инкубации в течение 3 (Т-клетки) или 4 (РВМС) дней при 37°C и 5% CO 2 клетки окрашивали на CD3 и CD4 (оба eBioscience) и анализировали с помощью проточной цитометрии. Для количественной оценки мы использовали моделирование пролиферации FlowJo V.10 и рассчитывали процентное соотношение для каждого образца.

    Статистический анализ

    Все данные были проверены на нормальность с помощью комплексного теста нормальности Д’Агостино и Пирсона. В зависимости от нормального распределения данные сравнивали с использованием либо критерия Стьюдента t , либо критерия Манна-Уитни U для двух групп.Для множественных сравнений при необходимости использовали односторонний ANOVA или критерий Крускала-Уоллиса с поправкой Данна. Данные выражены как медиана ± межквартильный размах (IQR), если не указано иное. Значения p <0,05 считались статистически значимыми. Для анализа и подготовки рисунков использовали GraphPad Prism Version 6.0h (GraphPad Software, Сан-Диего, Калифорния).

    Результаты

    Демографические характеристики исследуемой популяции

    Из 136 новорожденных 72 мальчика и 64 девочки.В 11 случаях новорожденные родились после гестационного возраста <37 недель (недоношенные), а 125 родились после ≥37 недель (доношенные). В целом гестационный возраст колебался от 241 до 294 дней со средним значением 276 дней. Восемьдесят шесть новорожденных родились через естественные родовые пути, пятьдесят родились с помощью кесарева сечения. Медиана веса при рождении составила 3445 г (диапазон 1490–4610 г). Из исследования были исключены новорожденные с признаками активной инфекции или более поздние поступления в отделение реанимации новорожденных. Здоровые взрослые контрольные группы имели средний возраст 25 лет (диапазон 22–50 лет).

    CB-LDG проявляют незрелый фенотип

    Для оценки состояния зрелости LDG и NDG из CB и взрослых контрольных NDG клетки выделяли и окрашивали для гистологического исследования. NDG из контрольной крови взрослых и CB показал фенотип от гомогенного сегментированного до гиперсегментированного, тогда как CB-LDG представляли собой в основном нейтрофилы полосчатого типа (рис. 1A). Чтобы дополнительно подтвердить наши микроскопические данные, мы провели проточный цитометрический анализ поверхностных молекул, которые, как известно, являются маркерами зрелости гранулоцитов (29) (рис.1Б–Е). Было обнаружено, что экспрессия CD66b и CD64 в качестве маркеров ранних стадий развития гранулоцитов значительно повышена у CB-LDG по сравнению с CB-NDG или у взрослых NDG. Соответственно, маркеры более поздних стадий развития, такие как CD16, CD10 и CD35, были ниже экспрессированы в CB-LDG по сравнению с CB-NDG и взрослым NDG.

    РИСУНОК 1.

    LDG из CB демонстрирует незрелый фенотип по сравнению с NDG из CB или периферической венозной крови взрослых. LDG и NDG были выделены из CB и взрослого NDG из периферической венозной крови.( A ) Репрезентативные микроскопические изображения полученных клеток, окрашенных по шкале Паппенгейма, 50 мкм. ( B F ) Клетки окрашивали на молекулы клеточной поверхности CD66b, CD16, CD64, CD35 и CD10 ( n = 3–16) и анализировали с помощью проточной цитометрии. Экспрессия показана как медиана интенсивности флуоресценции (±IQR). * p < 0,05, ** p < 0,01, *** p < 0,001, определено с помощью критерия Манна-Уитни U .

    Основываясь на выражении их различных поверхностных маркеров, CB-LDG могут быть непосредственно идентифицированы в цельной крови с помощью проточной цитометрии образцы без дальнейшей необходимости использования традиционных методов выделения, таких как центрифугирование в плотности фиколла.Поэтому мы провели проточный цитометрический анализ РВМС и целых ТК параллельно от одних и тех же доноров (рис. 2А, 2В). В образцах CB была обнаружена отдельная популяция Lin

    neg CD66b pos CD64 pos CD16 neg , которая фенотипически соответствовала изолированному LDG из PBMC. Кроме того, количество гранулоцитов рассчитывали с помощью автоматического дифференциального подсчета лейкоцитов от тех же доноров. Полученные проценты всех подтипов гранулоцитов сравнивали с субпопуляцией, идентифицированной с помощью проточной цитометрии, обнаруживая те же частоты для незрелых гранулоцитов (3.3 ± 2,15%) и LDG, окрашенный проточной цитометрией (3,35 ± 2,34%) (таблица I). См. Дополнительную таблицу I для индивидуальных дифференциальных подсчетов лейкоцитов. Статистический анализ показал очень значимую корреляцию с незрелыми гранулоцитами (рис. 2C; Spearman r = 0,9643; p = 0,003), что еще раз подтверждает предполагаемый незрелый фенотип CB-LDG. Соответственно, популяция Lin neg CD66b pos CD64 pos CD16 neg не могла быть обнаружена при окрашивании контрольной крови взрослых (рис.2Д).

    РИСУНОК 2.

    CB-LDG можно идентифицировать в цельной крови по маркерам зрелости и коррелировать с незрелыми гранулоцитами в дифференциальном анализе крови. Изолированные РВМС из CB, цельных CB и контрольных образцов крови взрослых окрашивали на поверхностные маркеры и анализировали с помощью проточной цитометрии. ( A ) ЛДГ в CB-PBMC были идентифицированы как Lin neg CD66b pos CD64 pos CD16 neg . ( B ) Соответствующие клетки Lin neg CD66b pos CD64 pos CD16 neg были обнаружены в образцах цельного CB.( C ) Были проведены дифференциальные анализы крови образцов CB, и количество незрелых гранулоцитов (IG) (ось x ) коррелировало с фракцией LDG, идентифицированной при окрашивании методом проточной цитометрии CB (ось y ). Корреляцию анализировали с использованием Спирмена r ( r = 0,9643; p = 0,0028). ( D ) Сопоставимая популяция Lin neg CD66b pos CD64 pos CD16 neg не была обнаружена во взрослых контрольных образцах.

    Таблица I. Дифференциальный анализ крови и окрашивание LDG в образцах CB

    S100A12 меньше экспрессируется в CB-LDG, но не в CB-NDG

    Для неонатального сепсиса большое клиническое значение имеют надежные диагностические маркеры. В этом контексте недавно было показано, что S100A12 является многообещающим кандидатом (25). Поскольку было обнаружено, что LDG обогащен у септических пациентов (11), нас интересовал потенциально отличный профиль экспрессии S100A12 в CB-LDG. Проточный цитометрический анализ CB-LDG, CB-NDG и взрослых NDG-контролей, внутриклеточно окрашенных для S100A12, выявил значительно более низкую экспрессию CB-LDG, но не имел существенной разницы между CB-NDG и взрослыми контролями NDG (рис.3А).

    РИСУНОК 3.

    CB-LDG показал более низкий общий уровень экспрессии S100A12 по сравнению с NDG. LDG и NDG были выделены из CB, а взрослые NDG служили контролем. Полученные клетки окрашивали на CD66b, CD16 и внутриклеточный S100A12 и анализировали с помощью проточной цитометрии. ( A ) Внутриклеточное окрашивание S100A12 в CB-LDG, CB-NDG и NDG взрослых, отображаемое в виде средней интенсивности флуоресценции (MFI). ( B ) Общее содержание клеточного белка S100A12 в 50 000 лизированных клеток, представленное как медиана ± IQR ( n = 7–9).** р < 0,01, *** р < 0,001, **** р < 0,0001. ( C ) Была проведена количественная ПЦР, и результаты показаны как относительные копии S100A12, нормализованные по генам домашнего хозяйства (RPL и GAPDH) ( n = 3). ( D ) Репрезентативный точечный график CB-LDG, взрослого NDG и гранулоцитов костного мозга (CD66b + ), показывающий экспрессию CD16 (ось x ) и S100A12 (ось y ). ( E ) Примеры иммунофлуоресцентных изображений, демонстрирующих экспрессию S100A12 в различных подмножествах нейтрофилов.Меньшие изображения отображают сверху вниз дифференциально-интерференционный контраст (DIC), DAPI и S100A12. На правом изображении показаны объединенные каналы S100A12 и DAPI. Масштабная линейка, 10 мкм.

    Чтобы подтвердить наши результаты проточной цитометрии, мы измерили общее содержание белка S100A12 в 50 000 лизированных CB-LDG, CB-NDG и взрослых NDG с помощью ELISA. Соответственно, значительно сниженные уровни белка S100A12 были обнаружены в CB-LDG по сравнению с CB-NDG или взрослым NDG (рис. 3B). Кроме того, была проведена qRT-PCR, которая выявила низкую экспрессию S100A12 в CB-LDG и взрослых NDG.Интересно, что самая высокая экспрессия мРНК была обнаружена в CB-NDG (рис. 3C). Поскольку CB-LDG демонстрируют незрелый фенотип, нас также интересовало, увеличивается ли экспрессия S100A12 при созревании нейтрофилов. Поэтому было проведено окрашивание проточной цитометрией на CD16 в качестве маркера зрелости в сочетании с S100A12 на CB-LDG и зрелом взрослом NDG (рис. 3D). С одной стороны, мы могли показать для CB-LDG (синий), что S100A12 не может быть обнаружен в незрелых клетках, не экспрессирующих CD16, тогда как экспрессия S100A12 увеличивалась по мере созревания, представленного умеренной экспрессией CD16.С другой стороны, полностью созревшие взрослые NDG (красные), как и ожидалось, экспрессировали высокие уровни как CD16, так и S100A12. Чтобы подтвердить предположение, что S100A12 увеличивается с созреванием, мы использовали аспираты цельного костного мозга в качестве известной популяции незрелых клеток. Гранулоциты костного мозга (зеленые) показали характер экспрессии CD16 и S100A12, сравнимый с CB-LDG (рис. 3D).

    Чтобы визуально подтвердить увеличение экспрессии S100A12 по мере созревания, на одном репрезентативном иммунофлуоресцентном изображении показаны три разные стадии зрелости нейтрофилов.Самая высокая экспрессия S100A12 была обнаружена в зрелых сегментоядерных нейтрофилах, за которыми следовали менее зрелые полосатые нейтрофилы, а самая низкая экспрессия наблюдалась в незрелых метамиелоцитах (рис. 3Е).

    Анализ сыворотки крови на S100A12 выявляет гендерные различия и увеличение уровней с гестационным возрастом

    Различия в экспрессии S100A12 между неонатальными LDG и NDG побудили нас к дальнейшему исследованию уровней белка S100A12 в сыворотке крови. Включая только здоровых новорожденных, мы смогли проанализировать 46 образцов CB и обнаружили значительную разницу по полу, причем новорожденные девочки демонстрируют более высокий медианный уровень S100A12 по сравнению с мальчиками (рис.4А). Кроме того, наблюдалась значительная корреляция гестационного возраста при родах с S100A12 в сыворотке CB с более высокими уровнями у лиц женского пола независимо от гестационного возраста (рис. 4B, 4C).

    РИСУНОК 4.

    S100A12 в сыворотке CB показывает гендерные различия и увеличивается с гестационным возрастом. S100A12 измеряли в сыворотке CB. Образцы включались в анализ, если они хранились менее 24 часов до центрифугирования и при первой клинической оценке не было обнаружено признаков инфекции. ( A ) Уровни S100A12 сравнивали между новорожденными женского пола ( n = 22) и мужского пола ( n = 22).На графике показана медиана (±IQR). *** p < 0,001, определено с помощью теста Манна-Уитни U . S100A12 (ось y ) в сыворотке CB был нанесен на график для новорожденных женского пола ( B ) и мужского пола ( C ) и сопоставлен с гестационным возрастом при родах (ось x ), показывая более высокие уровни для лиц женского пола независимо. от гестационного возраста.

    Гранулоциты CB функционально нарушены и демонстрируют длительную выживаемость

    Поскольку мы могли описать различия в зрелости субпопуляций гранулоцитов при CB, нас также интересовали функциональные изменения.Во-первых, мы смогли подтвердить (30), что CB-NDG демонстрирует сниженный фагоцитоз меченых флуорохромом E. coli по сравнению со взрослыми NDG. (рис. 5А). Наиболее выраженная разница наблюдалась на 20 мин (рис. 5Б). Другой важный механизм элиминации нейтрофильных патогенов заключается в образовании нейтрофильных внеклеточных ловушек (NET) (31). Поэтому нас интересовала способность нейтрофилов ЦБ образовывать НЭО. После заражения 100 нг/мл LPS или 100 нМ PMA было обнаружено, что NETosis нарушен в нейтрофилах низкой и нормальной плотности из CB по сравнению с контрольными взрослыми NDG (рис.5С, 5D). Поскольку мы обнаружили, что CB-LDG представляет собой незрелые гранулоциты, и уже было описано, что эти клетки демонстрируют более длительный срок жизни по сравнению с их полностью зрелыми аналогами (31–33), мы дополнительно оценили возможность отдельного выживания. Таким образом, нестимулированные субпопуляции гранулоцитов CB и взрослые NDG были окрашены на аннексин V и 7-амино-актиномицин D, демонстрируя апоптоз и некроз соответственно. Как и ожидалось, наибольшая выживаемость наблюдалась для незрелых CB-LDG, за которыми следовали более зрелые CB-NDG и взрослые NDG в виде полностью созревших гранулоцитов, показавших самую короткую выживаемость (рис.5E, дополнительный рис. 1).

    РИСУНОК 5.

    Функциональные свойства и выживаемость субпопуляций нейтрофилов CB. ( A ) Были выделены CB и нейтрофилы крови взрослых. Полученные клетки подвергали заражению мечеными флуорохромом штаммами E. coli и неоднократно измеряли фагоцитоз в течение 30 мин с помощью проточной цитометрии. ( B ) Процент E. coli и нейтрофилов через 20 минут отображается как медиана (+IQR). * p < 0,05, определено с помощью теста Манна-Уитни U .CB-LDG, CB-NDG и NDG взрослых стимулировали ( C ) 100 нг/мл rLPS или ( D ) 100 нМ PMA, а NETosis оценивали путем включения ДНК SYTOX Green и отображали как n — кратность относительных единиц флуоресценции (RFU ± IQR), измеренная для нестимулированных клеток в указанные моменты времени. ( E ) Выживаемость нестимулированных подмножеств нейтрофилов измеряли с течением времени путем окрашивания на 7-аминоактиномицин D (7-AAD) и аннексин V. Проточный цитометрический анализ выполняли в указанные моменты времени.

    Гранулоциты CB не проявляют прямого ингибирующего действия на пролиферацию Т-клеток, но проявляют стимулирующие фагоцитоз шарики

    Ранее было описано, что LDG проявляют функции GR-MDSC в неонатальных условиях (12). В качестве более общего подхода мы сначала провели эксперименты по совместному культивированию с CB и взрослыми контрольными Т-клетками и соответствующими WBG, чтобы оценить общее влияние на пролиферацию Т-клеток. Мы обнаружили зависящий от концентрации ингибирующий эффект добавления WBG к анализам пролиферации Т-клеток с использованием CD3/CD28 Dynabeads в качестве стимулятора.С другой стороны, когда тот же экспериментальный подход был выполнен с культуральными планшетами, покрытыми анти-CD3, и добавлением растворимого анти-CD28 Ab для стимуляции Т-клеток, ингибирующий эффект добавления WBG отсутствовал (фиг. 6A, 6B). Основываясь на этих наблюдениях, мы предположили, что гранулоциты могут оказывать влияние на стимулирующий агент, тем более что мы могли наблюдать эффект добавления WBG только тогда, когда для стимуляции Т-клеток использовались шарики. Следовательно, мы исследовали, способны ли WBG фагоцитировать обычно используемые гранулы для стимуляции.Наши результаты показывают, что нейтрофилы были способны поглощать частицы диаметром 4,5 мкм, аналогичные по размеру используемым шарикам для стимуляции (рис. 6С).

    РИСУНОК 6.

    Нейтрофилы не оказывают прямого влияния на пролиферацию Т-клеток, но опосредованно через фагоцитоз гранул стимуляции. Т-клетки и WBG были выделены от одних и тех же доноров для образцов CB и взрослых контролей. Пролиферацию индуцировали гранулами CD3/CD28 или CD3 с покрытием и растворимыми антителами против CD28, а также аутологичным WBG, добавленными в проиллюстрированных соотношениях.Т-клетки метили CFSE и CD3, а также CD4 и анализировали с помощью проточной цитометрии. ( A ) Показаны репрезентативные гистограммы пролиферирующих CD3 + CD4 + Т-клеток. Количественный анализ пролиферации проводили с использованием моделирования пролиферации FlowJo V10. Результаты для взрослых и Т-клеток CB после ( B ) стимуляции шариками или ( C ) стимуляции Ab отображаются в виде процентного деления (медиана + IQR). * р < 0,05, *** р < 0.001, определяемый непараметрическим критерием Манна-Уитни U . ( D ) Фагоцитоз микросфер YG (GFP, зеленый; диаметр 4,5 мкм) взрослыми WBG. Для идентификации плазматической мембраны клетки окрашивали красителем CellMask Plasma Membrane Stain (RFP, оранжевый). Масштабная линейка, 5 мкм.

    Поскольку мы не смогли обнаружить прямого ингибирующего действия CB-WBG на пролиферацию Т-клеток, мы сосредоточились на возможных эффектах, опосредованных CB-LDG. Поэтому мы стимулировали окрашенные CFSE РВМС из образцов CB и контрольной крови взрослых в соответствии с Rieber et al.(12) с растворимыми анти-CD3 и IL-2. Для исследования ингибирующего действия CB-LDG, обогащенных CB-PBMC, мы, с одной стороны, истощали эти клетки от CB-PBMC, а с другой стороны, повторно вводили CB-LDG в соотношении 1:2. к LDG-истощенным PBMC. Интересно, что удаление ЛДГ не приводило к увеличению пролиферации Т-клеток CD3 + CD4 + , но добавление CB-LDG в определенном соотношении неожиданно повышало пролиферацию Т-клеток (рис. 7).

    РИСУНОК 7.

    CB-LDG не ингибируют, а скорее усиливают пролиферацию CD4 + Т-клеток.CB и взрослые контрольные PBMC выделяли, метили CFSE и стимулировали растворимыми 100 ЕД/мл IL-2 и 1 мкг/мл CD3. CD66b + LDG либо удаляли из CB-PBMC, либо добавляли обратно в соотношении 1:2. Пролиферацию анализировали с помощью проточной цитометрии в пяти независимых экспериментах. ( A ) Репрезентативные гистограммы, гейтированные на CD4 + Т-клетках, показывающие пролиферацию, отображаемую разбавлением CFSE. ( B ) Моделирование пролиферации FlowJo проводили на CD4 + Т-клетках и отображали в виде процентного деления (медиана + IQR).* p < 0,05, ** p < 0,01, рассчитано по критерию Краскела–Уоллиса с поправкой Данна.

    Обсуждение

    ЛДГ были впервые описаны в 1986 г. у пациентов, страдающих системной красной волчанкой, ревматоидным артритом и острой ревматической лихорадкой Hacbarth et al. (5), а в последнее время также обнаружены при различных других состояниях, включая рак (9, 34, 35), аутоиммунные или аутовоспалительные заболевания (6–8, 30, 36), инфекционные заболевания (11, 16–18) и при ХБ. от здоровых человеческих беременностей (12, 13).Хотя они определяются как нейтрофильные клетки, обнаруженные в слое РВМС, результаты, касающиеся их происхождения и статуса зрелости, остаются противоречивыми. Существующие гипотезы описывают их либо как гетерогенную группу нейтрофильных предшественников и зрелых клеток (31), либо как уже дегранулированные стареющие нейтрофилы (16). В неонатальном периоде LDG впервые были описаны как популяция CD66b + CD33b + HLA-DR low нейтрофильных клеток (12). Дальнейшие исследования показали снижение экспрессии CD16 и аргиназы 1 и повышение экспрессии CD66b, CD15 и CD63 (13).В нашем исследовании окрашенные по Гимзе CB-LDG демонстрируют относительно гетерогенную популяцию со значительным процентом незрелых нейтрофильных предшественников. В соответствии с нашими результатами по экспрессии маркера клеточной поверхности, характеризующими CB-LDG как CD16 низкий CD10 низкий CD35 низкий CD64 высокий , мы предполагаем, что эти клетки состоят из высокой доли незрелых клеток и лишь нескольких более зрелые нейтрофилы.

    Отсутствие установленного маркера ЛДГ в организме человека по-прежнему требует проведения многочисленных процедур выделения наряду с возможным праймированием и/или активацией.В результате наших выводов о фенотипе ЛДГ мы обнаружили, что окрашивание на CD66b, CD16 и CD64 позволяет напрямую идентифицировать ЛДГ с помощью проточного цитометрического анализа в цельной крови. Поскольку клетки CB могут иметь ограничение, отражающее только переходное состояние (37), важно дальнейшее изучение этого типа клеток также в постнатальном периоде. Тем не менее, наш подход позволит в будущих исследованиях сравнивать уровни ЛДГ с помощью надежного и воспроизводимого метода, обходя потребность в больших объемах неонатальной крови, необходимой для процедур разделения клеток.Сильная корреляция с незрелыми гранулоцитами в обычных показателях периферической крови снова подчеркивает незрелый фенотип CB-LDG.

    S100A12 является членом семейства белков S100 и описан как лиганд RAGE и TLR4 (19). Он действует как DAMP (19) и обладает противомикробными (21) и противопаразитарными (22) функциями. Более того, он используется для диагностики и мониторинга ювенильного идиопатического артрита (23) и недавно был предложен в качестве полезного прогностического биомаркера неонатального сепсиса (25).Насколько нам известно, мы могли впервые показать, что S100A12, как правило, имеет более низкую экспрессию в CB-LDG по сравнению с NDG либо из CB, либо из контроля взрослых. Результаты проточной цитометрии были дополнительно подтверждены с помощью ELISA клеточных лизатов и qRT-PCR. Таким образом, мы предполагаем, что нейтрофилы начинают продуцировать S100A12 на более поздних стадиях созревания, поскольку CB-LDG представляют собой гетерогенную группу нейтрофильных предшественников и незрелых клеток. Действительно, эта гетерогенность также присутствовала в экспрессии S100A12 CB-LDG, обнаруживая фракции S100A12 high и S100A12 low .Фракция S100A12 high напоминала более зрелые гранулоциты, представленные умеренным увеличением экспрессии CD16. Чтобы еще больше подтвердить наше предположение, мы проанализировали гранулоциты в аспиратах костного мозга как источник незрелых клеток. Соответственно, наблюдалась сопоставимая картина сопутствующего увеличения CD16 и S100A12, наблюдаемая в CB-LDG. Поскольку CD16 является маркером как зрелости, так и активации, мы дополнительно оценили экспрессию S100A12 с помощью флуоресцентной микроскопии и смогли доказать, что более ранние стадии развития нейтрофилов демонстрируют более низкие уровни белка S100A12.

    Интересно, что CB-NDG показал самую высокую экспрессию гена S100A12 по сравнению как с CB-LDG, так и со взрослыми NDG. Одним из объяснений может быть то, что взрослые NDG уже достигли состояния равновесной экспрессии, тогда как CB-LDG еще не способны к синтезу S100A12, а немного более зрелые CB-NDG начинают заполнять свои запасы белка, активно продуцируя S100A12.

    Взятые вместе, наши результаты указывают на различную картину синтеза и экспрессии для различных белков S100, поскольку, например, S100A9, как было описано, более экспрессируется в незрелых CB—LDG (12).

    Поскольку недавно было описано, что S100A12 является потенциальным сывороточным биомаркером неонатального сепсиса (25), мы провели анализ сыворотки и сравнили результаты с клиническими признаками. Мы смогли показать, что уровни S100A12 постепенно увеличивались с гестационным возрастом, что вполне возможно, учитывая, что абсолютное количество нейтрофилов также увеличивается с гестационным возрастом (38). В соответствии с этим общее более высокое количество нейтрофилов у новорожденных девочек (38) может объяснить более высокую концентрацию S100A12.Это может частично отражать снижение смертности и заболеваемости среди недоношенных девочек того же гестационного возраста (39).

    Описано, что гранулоциты CB демонстрируют функциональные нарушения во многих отношениях, по крайней мере частично связанные с незрелыми формами (40). В нашем исследовании мы смогли подтвердить, что они действительно демонстрируют снижение скорости фагоцитоза и НЕТоза. Мы могли дополнительно продемонстрировать, что образование NET с помощью CB-LDG снижается и начинается в более поздний момент времени по сравнению со взрослыми или CB-NDG, что резко контрастирует с описанным повышенным и спонтанным NETosis в других условиях, таких как системная красная волчанка. 15).Это различие может быть связано с незрелым статусом CB-LDG в отличие от в основном гиперсегментированных нейтрофилов, обнаруживаемых при системной красной волчанке (15).

    Кроме того, общая незрелость CB-LDG, возможно, может объяснить опубликованное увеличение выживаемости (12) и наблюдаемое постепенное увеличение показателей гибели клеток в наших экспериментах, начиная от самого низкого уровня, обнаруженного в CB-LDG через CB-NDG, до самого высокого, наблюдаемого в взрослый НДГ.

    Совсем недавно LDG стали обозначать термином GR-MDSC из-за наблюдаемого антипролиферативного действия на Т-клетки.Это явление было впервые описано у онкологических больных (41), а затем у больных ВИЧ (10) или сепсисом (11). Было описано, что CB-LDG оказывает сопоставимое прямое, зависимое от контакта ингибирующее действие на пролиферацию CD4 + Т-клеток (12, 31). В нашем исследовании мы могли наблюдать эффект подавления исключительно CB-WBG на пролиферацию Т-клеток, когда гранулы использовались для стимуляции Т-клеток. Поэтому мы предположили, что нейтрофилы могут мешать действию стимулирующего агента. Действительно, мы смогли показать, что нейтрофилы способны фагоцитировать стандартные гранулы стимуляции, часто используемые для анализа пролиферации Т-клеток.Более того, наблюдаемый эффект был более выражен у взрослых WBG, которые обладают более сильным потенциалом фагоцитоза, что еще раз подтверждает предположение. Таким образом, мы предполагаем, что, по крайней мере, в недавней литературе (31) подавление Т-клеток могло быть связано с устранением раздражителя. Для дальнейшей оценки функции CB-LDG на пролиферацию Т-клеток мы провели анализ пролиферации с РВМС в соответствии с уже опубликованными протоколами (12, 42). Истощая потенциально супрессорные CB-LDG из CB-PBMC, мы не могли увеличить пролиферацию Т-клеток CD4.В соответствии с этим добавление CB-LDG обратно в культуру в определенном соотношении 1:2 не приводило к снижению пролиферации, как описано Rieber et al. (12). Таким образом, в наших условиях CB-LDG не оказывал антипролиферативного действия на CD4 + Т-клеток. Исследование Марини и соавт. (43) обнаружили, что у доноров стволовых клеток, обработанных Г-КСФ, ЛДГ оказывает как супрессивное, так и индуцирующее действие на пролиферацию Т-клеток, в зависимости от экспрессии CD10. В этих экспериментах только зрелые гранулоциты, экспрессирующие CD10, оказывали супрессивное действие, тогда как незрелые гранулоциты, не экспрессирующие CD10, сравнимые с CB-LDG в нашем исследовании, приводили к пролиферации Т-клеток и индукции клеток Th2 (43).Кроме того, влияние CB-LDG на субпопуляции клеток Th было опубликовано Köstlin et al. (42) демонстрирует подавление клеток Th2, но индукцию пролиферации клеток Th3. Интересно, что при патологических состояниях, таких как рак (44) и сепсис (11), незрелые ЛДГ проявляли иммунодепрессивные функции, тогда как при малярии (17) и кожном лейшманиозе (18) зрелые ЛДГ не оказывали подавляющего действия на пролиферацию Т-клеток.

    Эти противоречивые результаты еще раз подчеркивают гетерогенность и сложность этого подмножества клеток и необходимость дальнейшей характеристики GR-MDSC, помимо их различной плотности.Недавно повышенная экспрессия рецептора 1 окисленного ЛПНП лектинового типа была предложена в качестве многообещающего поверхностного маркера для идентификации GR-MDSC (45). Однако для проверки потребуются дальнейшие исследования.

    В заключение мы предоставляем дополнительные сведения о фенотипе и функциональности гранулоцитов CB, особенно учитывая их различную экспрессию S100A12. Более того, общее увеличение концентрации S100A12 у новорожденных женского пола может быть обнаружено, что коррелирует с более высоким количеством гранулоцитов и, таким образом, указывает на более зрелую врожденную иммунную систему при аналогичном гестационном возрасте у девочек.Кроме того, наши результаты показывают, что подход к прямой идентификации CB-LDG с помощью проточной цитометрии может помочь в дальнейшем изучении различных субпопуляций CB-LDG. Наконец, результаты, касающиеся влияния ЛДГ на пролиферацию Т-клеток, остаются противоречивыми, возможно, из-за различных исходных материалов клеток и их слабой характеристики, в настоящее время основанной только на их клеточной плотности и присутствии во фракции РВМС. Необходимы дальнейшие исследования возможных подтипов ЛДГ и их особой роли в иммунной системе.

    | Ядерная морфология определяет зрелость подмножеств LDG. Гейтирование…

    Контекст 1

    … одна треть популяции LDG была CD16 и CD10-отрицательной, что позволяет предположить, что эти клетки представляют собой незрелые нейтрофилы, возможно представляющие собой миелобласты, промиелоциты или метамиелоциты. Поэтому мы использовали визуализирующую проточную цитометрию для дальнейшей характеристики подмножеств LDG одновременно как по экспрессии поверхностных маркеров, так и по ядерной морфологии (рис. 4). Объединенные изображения ясно показывают, что клетки CD15 + CD16 + являются многодольчатыми, в то время как клетки CD15 + CD16 int/- имеют круглые или почковидные ядра (рис. 4A, B), причем последние сочетают незрелую форму ядра с отсутствием окрашивания CD10, по сравнению с популяцией CD15+CD16+, которая сильно положительна по CD10….

    Контекст 2

    … мы использовали визуализирующую проточную цитометрию для дальнейшей характеристики подмножеств LDG одновременно как по экспрессии поверхностных маркеров, так и по ядерной морфологии (рис. 4). Объединенные изображения ясно показывают, что клетки CD15 + CD16 + являются многодольчатыми, в то время как клетки CD15 + CD16 int/- имеют круглые или почковидные ядра (рис. 4A, B), причем последние сочетают незрелую форму ядра с отсутствием окрашивания CD10, по сравнению с популяцией CD15+CD16+, которая сильно положительна по CD10.Чтобы дополнительно подтвердить эти результаты, мы количественно определили количество ядерных долей во всех клетках в популяциях CD15 + CD16 + и CD15 + CD16 int/-, используя автоматический анализ набора данных цитометрии изображений. …

    Контекст 3

    … для дальнейшего подтверждения этих результатов мы количественно определили количество ядерных долей во всех клетках в популяциях CD15 + CD16 + и CD15 + CD16 int/- с использованием автоматизированного анализа цитометрии изображений набор данных. CD16 + LDG имели медиану 2 доли, тогда как CD16 int/- LDG имели медиану 1 доли (рис. 4C)….

    Контекст 4

    … одна треть популяции LDG была CD16 и CD10-отрицательной, что позволяет предположить, что эти клетки представляют собой незрелые нейтрофилы, возможно, представляющие собой миелобласты, промиелоциты или метамиелоциты. Поэтому мы использовали визуализирующую проточную цитометрию для дальнейшей характеристики подмножеств LDG одновременно как по экспрессии поверхностных маркеров, так и по ядерной морфологии (рис. 4). Объединенные изображения ясно показывают, что клетки CD15 + CD16 + являются многодольчатыми, в то время как клетки CD15 + CD16 int/- имеют круглые или почковидные ядра (рис. 4A, B), причем последние сочетают незрелую форму ядра с отсутствием окрашивания CD10, по сравнению с популяцией CD15+CD16+, которая сильно положительна по CD10….

    Контекст 5

    … мы использовали визуализирующую проточную цитометрию для дальнейшей характеристики подмножеств LDG одновременно как по экспрессии поверхностных маркеров, так и по ядерной морфологии (рис. 4). Объединенные изображения ясно показывают, что клетки CD15 + CD16 + являются многодольчатыми, в то время как клетки CD15 + CD16 int/- имеют круглые или почковидные ядра (рис. 4A, B), причем последние сочетают незрелую форму ядра с отсутствием окрашивания CD10, по сравнению с популяцией CD15+CD16+, которая сильно положительна по CD10.Чтобы дополнительно подтвердить эти результаты, мы количественно определили количество ядерных долей во всех клетках в популяциях CD15 + CD16 + и CD15 + CD16 int/-, используя автоматический анализ набора данных цитометрии изображений. …

    Контекст 6

    … для дальнейшего подтверждения этих результатов мы количественно определили количество ядерных долей во всех клетках в популяциях CD15 + CD16 + и CD15 + CD16 int/- с использованием автоматизированного анализа цитометрии изображений набор данных. CD16 + LDG имели медиану 2 доли, тогда как CD16 int/- LDG имели медиану 1 доли (рис. 4C)….

    Контекст 7

    … одна треть популяции LDG была CD16 и CD10-отрицательной, что позволяет предположить, что эти клетки представляют собой незрелые нейтрофилы, возможно, представляющие собой миелобласты, промиелоциты или метамиелоциты. Поэтому мы использовали визуализирующую проточную цитометрию для дальнейшей характеристики подмножеств LDG одновременно как по экспрессии поверхностных маркеров, так и по ядерной морфологии (рис. 4). Объединенные изображения ясно показывают, что клетки CD15 + CD16 + являются многодольчатыми, в то время как клетки CD15 + CD16 int/- имеют круглые или почковидные ядра (рис. 4A, B), причем последние сочетают незрелую форму ядра с отсутствием окрашивания CD10, по сравнению с популяцией CD15+CD16+, которая сильно положительна по CD10….

    Context 8

    … мы использовали визуализирующую проточную цитометрию для дальнейшей характеристики подмножеств LDG одновременно как по экспрессии поверхностных маркеров, так и по ядерной морфологии (рис. 4). Объединенные изображения ясно показывают, что клетки CD15 + CD16 + являются многодольчатыми, в то время как клетки CD15 + CD16 int/- имеют круглые или почковидные ядра (рис. 4A, B), причем последние сочетают незрелую форму ядра с отсутствием окрашивания CD10, по сравнению с популяцией CD15+CD16+, которая сильно положительна по CD10.Чтобы дополнительно подтвердить эти результаты, мы количественно определили количество ядерных долей во всех клетках в популяциях CD15 + CD16 + и CD15 + CD16 int/-, используя автоматический анализ набора данных цитометрии изображений. …

    Контекст 9

    … для дальнейшего подтверждения этих результатов мы количественно определили количество ядерных долей во всех клетках в популяциях CD15 + CD16 + и CD15 + CD16 int/- с использованием автоматизированного анализа цитометрии изображений набор данных. CD16 + LDG имели медиану 2 доли, тогда как CD16 int/- LDG имели медиану 1 доли (рис. 4C)….

    Субпопуляция нейтрофилов, экспрессирующих маркеры антигенпрезентирующих клеток при висцеральном лейшманиозе человека | Журнал инфекционных болезней

    История вопроса

    Висцеральный лейшманиоз (ВЛ) представляет собой потенциально смертельное паразитарное заболевание, связанное с лихорадкой, кахексией и нарушением защитных Т-клеточных реакций против паразита.

    Методы

    Лейкоциты периферической крови 105 субъектов с ВЛ и здоровых лиц из контрольной группы из эндемического региона Музаффарпур, штат Бихар, Индия, сравнивали с использованием проточной цитометрии и количественной полимеразной цепной реакции с обратной транскриптазой.Полученные данные коррелировали с клиническими данными.

    Результаты

    У пациентов с ВЛ наблюдалась расширенная популяция нейтрофилов низкой плотности, экспрессирующих HLA-DR, CD80 и CD86. Эта популяция нейтрофилов сократилась после успешного лечения заболевания. Плазма пациентов с острым ВЛ способна индуцировать аналогичную экспрессию HLA-DR высокого уровня в нейтрофилах здоровых субъектов. Нейтрофилы HLA-DR + от субъектов с ВЛ не стимулировали пролиферацию Т-клеток, но они действительно экспрессировали лиганд-1 запрограммированной гибели клеток (PDL1) в большей степени, чем другие нейтрофилы, а лимфоциты тех же субъектов экспрессировали высокую запрограммированную гибель клеток 1 ( ПД1).

    Выводы

    У пациентов с острым ВЛ наблюдается увеличение циркулирующих нейтрофилов низкой плотности, экспрессирующих маркеры презентации антигена, которые уменьшаются после лечения. Развитие нейтрофилов HLA-DR + стимулируется, по крайней мере частично, компонентами плазмы пациентов с острым заболеванием. Хотя мы не нашли доказательств того, что они действуют как антигенпрезентирующие клетки, эти нейтрофилы экспрессировали маркеры, свидетельствующие о роли Т-клеточного истощения.

    Лейшманиоз относится к группе синдромов различной степени тяжести от самозаживающих кожных язв до смертельной висцеральной инфекции.Все формы лейшманиоза в подавляющем большинстве случаев связаны с бедностью [1]. Возбудитель Leishmania spp. простейшие передаются человеку через укус самки москита-гематофага (род Phlebotomus в Старом Свете, Lutzomyia в Новом Свете). Висцеральный лейшманиоз (ВЛ) является наиболее тяжелой формой лейшманиоза, вызываемой либо Leishmania donovani в Индии и Судане, либо Leishmania infantum в Южной Америке и странах, граничащих со Средиземноморьем.В глобальном масштабе ВЛ уступает только малярии как причина смерти от паразитарных заболеваний [2].

    Leishmania spp. являются облигатными внутриклеточными паразитами у своих хозяев-млекопитающих, которые наблюдались в нейтрофилах (полиморфноядерных лейкоцитах), моноцитах, макрофагах и дендритных клетках [3]. Хотя большинство паразитов обитает в макрофагах на протяжении всей хронической инфекции, недавние исследования подтверждают тот факт, что нейтрофилы быстро рекрутируются в место инокуляции, где они интернализуют паразитов.Конечное влияние нейтрофилов на исход лейшманиоза остается спорным, отчасти из-за различных методов, используемых для истощения нейтрофилов, и использования различных видов паразитов и линий мышей в исследованиях [4, 5]. Тем не менее, несколько исследований подтверждают наблюдение, что нейтрофилы помогают паразиту установить инфекцию [6]. По-видимому, это происходит, по крайней мере частично, из-за их воздействия на макрофаги или дендритные клетки, которые интернализуют нейтрофилы, нагруженные паразитами [7]. Однако еще предстоит задокументировать, играют ли нейтрофилы роль в хроническом лейшманиозе.

    Нейтрофилы неоднородны. Подмножества нейтрофилов с различными фенотипическими или функциональными характеристиками включают поляризованные N1 (противоопухолевые) или N2 (проопухолевые) ассоциированные с опухолью нейтрофилы, которые высвобождают провоспалительные и ангиогенные факторы соответственно [8]. Нейтрофилы низкой плотности, очищающиеся в градиенте плотности с мононуклеарными клетками крови, наблюдались в контексте аутоиммунных заболеваний, особенно системной красной волчанки, в спорадических отчетах, начиная с 1986 г. [9].Также сообщается, что супрессивные гранулоцитарные субпопуляции супрессорных клеток миелоидного происхождения (G-MDSC) мигрируют во фракции лейкоцитов низкой плотности [10]. Недавно было обнаружено, что фракции мононуклеарных клеток периферической крови (PBMC) эфиопских пациентов с активной ВЛ содержат CD15 + нейтрофилов с высоким уровнем аргиназы, а истощение аргинина было связано с подавлением активности Т-клеток [11]. Параллельно с этими сообщениями сообщалось о субпопуляциях нейтрофилов, экспрессирующих HLA-DR и другие костимулирующие молекулы с некоторыми функциональными возможностями, при аутоиммунных заболеваниях [12-15].Спектр клинических условий, при которых подмножества нейтрофилов многочисленны, а происхождение и функциональные возможности подмножеств нейтрофилов плохо определены.

    Вдохновленные потенциальным влиянием нейтрофилов на функцию Т-клеток, мы рассмотрели гипотезу о том, что могут существовать подмножества циркулирующих нейтрофилов со способностью влиять на клеточный иммунный ответ у субъектов с острым ВЛ. Мы подтвердили увеличенную популяцию нейтрофилов низкой плотности у пациентов с ВЛ, как сообщалось Abebe et al [11].Мы обнаружили, что эта популяция содержит другую подгруппу нейтрофилов, экспрессирующую HLA-DR и другие поверхностные маркеры антигенпрезентирующих клеток (APC), что указывает на то, что 2 зарегистрированных «подгруппы» нейтрофилов перекрываются. Исследования этих нейтрофилов предполагают, что нейтрофилы HLA-DR + , возникающие при ВЛ, не стимулируют ответы Т-лимфоцитов, но могут играть альтернативную роль в патогенезе ВЛ.

    МЕТОДЫ

    Люди

    пациента с ВЛ были набраны из Медицинского исследовательского центра Кала-Азар (KAMRC) в Музаффарпуре, штат Бихар, Индия.Диагноз основывался на наличии типичных симптомов и подтверждался обнаружением амастигот в аспирате селезенки и/или антител к рекомбинантному антигену k39 с использованием имеющегося в продаже тест-полоски (InBios Kala Azar Detect Rapid Test). Дополнительными критериями включения были возраст старше 12 лет, отсутствие беременности, способность дать информированное согласие и ответ на терапию амфотерицином В. Все субъекты, включенные в исследование, не имели вируса иммунодефицита человека.

    Сертификаты этики

    Протоколы, использованные в этом исследовании, были одобрены институциональными наблюдательными советами в Банарасском индуистском университете, Университете Айовы и Национальных институтах здравоохранения (NIH).Институциональный наблюдательный совет Банарасского индуистского университета зарегистрирован в NIH. Все субъекты и/или опекуны предоставили письменное информированное согласие, а дети в возрасте 12–17 лет подписали форму согласия.

    Препараты клеток периферической крови человека

    Для получения клеток периферической крови использовали три метода:

    • 1. Цельная кровь. Сначала 100 мкл гепаринизированной цельной крови инкубировали с панелью для окрашивания желаемых антител в течение 30 минут в темноте.Затем образцы инкубировали в 2 мл буфера для лизиса эритроцитов (Becton Dickinson) в течение 15 минут, после чего их промывали фосфатно-солевым буфером (PBS) путем центрифугирования и ресуспендировали в PBS с 0,1% бычьим сывороточным альбумином для проточной цитометрии.

    • 2. Нейтрофилы низкой и нормальной плотности. Сначала 5 мл крови разделяли по плотности с использованием градиентов Ficoll Hypaque (Ambion; Thermo-Fischer Scientific), как описано для выделения РВМС [16]. После центрифугирования слой с низкой плотностью, мигрирующий над слоем фиколла, собирали и суспендировали в среде Мемориального института Розуэлл-Парк с 10% термоинактивированной фетальной телячьей сывороткой, пенициллином (100 ЕД/мл) и стрептомицином (50 мкг/мл).Гранулоциты нормальной плотности (NDG) под слоем фиколла и над эритроцитарным «пеллетом» (лейкоцитарной пленкой) выделяли путем гипотонического лизиса эритроцитов (15 минут; буфер для лизиса RBC; BD Biosciences) и центрифугирования (300 g ; 10 минут). ). Препараты клеток использовали для окрашивания для проточной цитометрии.

    • 3. Изолированные клетки CD66b + . Эритроциты в 15 мл свежезабранной периферической крови лизировали в 5–10 объемах лизирующего буфера (155 ммоль/л хлорида аммония, 10 ммоль/л бикарбоната калия и 0.1 ммоль/л этилендиаминтетрауксусной кислоты) в течение 10 минут при комнатной температуре. Клетки промывали центрифугированием и ресуспендировали в буфере колонки для разделения клеток MACS(R)™ (Miltenyi) (0,5% бычьего сывороточного альбумина и 2 ммоль/л этилендиаминтетрауксусной кислоты в ×1 PBS). Нейтрофилы обогащали путем положительной селекции с использованием набора CD66abce MicroBead Kit с колонкой Magnetic LS в соответствии с протоколом, описанным производителем (Miltenyi Biotec).

    Проточная цитометрия

    Клетки периферической крови были окрашены антителами, конъюгированными с флуоресцентными маркерами, в KAMRC, зафиксированы и доставлены в Индийский университет Бенарас для анализа.Антитела были следующими (с каталожными номерами BD Biosciences): CD66b (555724), CD62L (555544), CD11b/Mac1 (550019), CD86 (555660), CD80 (557227), CD15 (555401). HLA-DR (347364), CD66b (562254), CD3 (555333), CD14 (555397), CD63 (557305). Данные собирали на проточном цитометре FACSCalibur модели 4CS (BD Biosciences).

    Экстракция РНК и экспрессия генов

    Нейтрофилы, очищенные с помощью набора Militenyi CD66abce MicroBead, суспендировали в RNAlater (Qiagen) и выделяли тотальную РНК с использованием набора RNeasy Mini Kit и гомогенизаторов Qiashredder (Qiagen).Комплементарную ДНК (кДНК) синтезировали с помощью набора High-Capacity cDNA Archive (Applied Biosystems) с использованием случайных праймеров и обратной транскриптазы MultiScribe MuLV. Количественную полимеразную цепную реакцию проводили на системе ABI Prism 7900HT с использованием праймеров, перечисленных в таблице 1. Изменения кратности рассчитывали с использованием ΔΔCT с микроглобулином β 2 в качестве эндогенного контроля. Обилие транскриптов пациентов сравнивали со средним значением у эндемичных здоровых контрольных субъектов.

    GCTCAAGTGCAGCAAAGAGA
    Стенограмма . Передняя грунтовка . Обратный грунт . 90 076
    аргиназы-1 5′-GTTTCTCAAGCAGACCAGCC-3 ‘
    β 2 -микроглобулин 5′-CTCCGTGGCCTTAGCTGTG-3′ 5′-TTTGGAGTACGCTGGATAGCCT-3 ‘
    HLA-DR 5′-TCCGTCCCATTGAGAATG-3 ‘ 5′-AGTGACTGATGATGGTGCTGAG-3′
    IL-10 5′-GGTGATGCCCCCAAGCTGA-3 ‘ 5′-TCCCCCAGGGAGTTCACA-3′
    Интерферон-γ 5′-CCAACGCAAAGCAATACATGA-3 ‘ 5′-CGCTTCCCTGTTTTAGCTGC-3′
    TGF-β 5′-GCAGAAGTTGGCATGGTAGC-3 ‘ 5′-CCCTGGACACCAACTATTGC-3′
    GCTCAAGTGCAGCAAAGAGA
    Стенограмма . Передняя грунтовка . Обратный грунт . 90 076
    аргиназы-1 5′-GTTTCTCAAGCAGACCAGCC-3 ‘
    β 2 -микроглобулин 5′-CTCCGTGGCCTTAGCTGTG-3′ 5′-TTTGGAGTACGCTGGATAGCCT-3 ‘
    HLA-DR 5′-TCCGTCCCATTGAGAATG-3 ‘ 5′-AGTGACTGATGATGGTGCTGAG-3′
    IL-10 5′-GGTGATGCCCCCAAGCTGA-3 ‘ 5′-TCCCCCAGGGAGTTCACA-3′
    Интерферон-γ 5′-CCAACGCAAAGCAATACATGA-3 ‘ 5′-CGCTTCCCTGTTTTAGCTGC-3′
    TGF-β 5′-GCAGAAGTTGGCATGGTAGC-3 ‘ 5′-CCCTGGACACCAACTATTGC-3′
    GCTCAAGTGCAGCAAAGAGA
    Стенограмма . Передняя грунтовка . Обратный грунт . 90 076
    аргиназы-1 5′-GTTTCTCAAGCAGACCAGCC-3 ‘
    β 2 -микроглобулин 5′-CTCCGTGGCCTTAGCTGTG-3′ 5′-TTTGGAGTACGCTGGATAGCCT-3 ‘
    HLA-DR 5′-TCCGTCCCATTGAGAATG-3 ‘ 5′-AGTGACTGATGATGGTGCTGAG-3′
    IL-10 5′-GGTGATGCCCCCAAGCTGA-3 ‘ 5′-TCCCCCAGGGAGTTCACA-3′
    Интерферон-γ 5′-CCAACGCAAAGCAATACATGA-3 ‘ 5′-CGCTTCCCTGTTTTAGCTGC-3′
    TGF-β 5′-GCAGAAGTTGGCATGGTAGC-3 ‘ 5′-CCCTGGACACCAACTATTGC-3′
    GCTCAAGTGCAGCAAAGAGA
    Стенограмма . Передняя грунтовка . Обратный грунт . 90 076
    аргиназы-1 5′-GTTTCTCAAGCAGACCAGCC-3 ‘
    β 2 -микроглобулин 5′-CTCCGTGGCCTTAGCTGTG-3′ 5′-TTTGGAGTACGCTGGATAGCCT-3 ‘
    HLA-DR 5′-TCCGTCCCATTGAGAATG-3 ‘ 5′-AGTGACTGATGATGGTGCTGAG-3′
    IL-10 5′-GGTGATGCCCCCAAGCTGA-3 ‘ 5′-TCCCCCAGGGAGTTCACA-3′
    Интерферон-γ 5′-CCAACGCAAAGCAATACATGA-3 ‘ 5′-CGCTTCCCTGTTTTAGCTGC-3′
    TGF-β 5′-GCAGAAGTTGGCATGGTAGC-3 ‘ 5′-CCCTGGACACCAACTATTGC-3′

    РЕЗУЛЬТАТЫ

    субъектов

    VL, вызванный L.donovani был эндемичным в Бихаре и прилегающих штатах с конца 1800-х годов [17]. Аспирация селезенки с микроскопическим исследованием амастигот Leishmania является стандартной диагностической процедурой для ВЛ в ​​Индии. В дополнение к диагностике микроскопический анализ аспиратов селезенки позволяет приблизительно оценить тяжесть заболевания в диапазоне от самой высокой (5) до самой низкой (1) паразитарной нагрузки. К участию в исследовании приглашались лица с подтвержденным диагнозом ВЛ при поступлении в КАМНЦ.В период с июля 2013 г. по август 2016 г. было включено в общей сложности 105 субъектов (36 женщин и 69 мужчин). Образцы крови были взяты в 0-й день до лечения, но после подтверждения диагноза ВЛ. Всех пациентов лечили в больнице амфотерицином В либо в его дезоксихолатной, либо в липосомальной форме в течение 30 дней [18] с исчезновением симптоматики заболевания. Второй образец крови был получен после завершения лечения, перед выпиской из стационара. Здоровые эндемичные контрольные субъекты были отобраны из членов домохозяйств пациентов, которые сопровождали пациентов с ВЛ в ​​КАМНЦ (n = 31).Кровь от здоровых контролей была собрана и обработана с образцами пациентов. Серьезных осложнений или летальных исходов у пациентов, включенных в это исследование, не было.

    Клинические характеристики

    Пациенты проходят общий анализ крови при поступлении в КАМНЦ. Данные в дополнительной таблице 1A показывают совокупное количество клеток крови и результаты клинической химии у 573 пациентов с активным ВЛ, поступивших в KAMRC. Данные исключительно по первым 83 субъектам текущего исследования перечислены в дополнительной таблице 1B.Оба набора данных документируют лейкопению во время острого заболевания, которая разрешилась после терапии. Как и ожидалось, уровни печеночных трансаминаз не были повышены. У субъектов не развивалось значительное нарушение функции почек (измеряемое по уровню креатинина в сыворотке) в конце терапии. У 573 пациентов, поступивших с ВЛ в ​​медицинский центр, не было заметной корреляции между продолжительностью лихорадки (среднее [стандартное отклонение [СО], 43,8 [1,7] дня) и числом нейтрофилов в день 0 до лечения ( R 2 = 0.00302; P = 0,19; коэффициент корреляции Пирсона). Однако наблюдалась слабая обратная корреляция между тяжестью заболевания по шкале селезенки и числом периферических нейтрофилов у 573 пациентов с ВЛ (среднее значение [SD], 1612 [889] или 1187 [620] нейтрофилов/мл, с оценкой селезенки 1 или 5 соответственно; P < 0,05).

    Лейкоциты в препаратах цельной крови

    Проточной цитометрии цельной крови было достаточно, чтобы отличить нейтрофилы от моноцитов и лимфоцитов.Нейтрофилы были отобраны в образцах цельной крови в соответствии с их свойствами прямого и бокового рассеяния, как индикаторы размера и зернистости, а также в соответствии с их окрашиванием на маркер нейтрофилов CD66b. Идентичность этих закрытых клеток подтверждали окрашиванием на дополнительный маркер нейтрофилов (CD15), маркер моноцитов (CD14) и маркер лимфоцитов (CD3). Было четкое разделение между нейтрофилами CD66b + CD15 + и либо моноцитами CD14 + , либо лимфоцитами CD3 + (дополнительная фигура 1).Аналогичное разделение было показано между нейтрофилами и лимфоцитами CD4 + или CD8 + (не показано).

    HLA-DR-экспрессирующие нейтрофилы в цельной крови субъектов с VL

    Проточные цитометрические исследования фенотипов нейтрофилов неожиданно выявили, что большая часть нейтрофилов периферической крови у субъектов с ВЛ окрашивается на маркер HLA-DR. Это показано на графике потока проб и на графиках, суммирующих результаты для группы пациентов с ВЛ до лечения или после полного курса терапии, или в эндемичных контрольных группах (рис. 1).

    Рисунок 1.

    Обнаружение нейтрофилов, экспрессирующих HLA-DR, в цельной крови субъектов с висцеральным лейшманиозом (ВЛ). Периферическую венозную кровь собирали у субъектов с активной ВН до лечения (ВЛ) или после 28 дней лечения и перед выпиской (Тх). Кровь собирали у здоровых эндемичных контрольных субъектов (продолжение) в течение того же периода. Лейкоциты цельной крови окрашивали для проточной цитометрии и гейтировали нейтрофилы, как показано на дополнительной фигуре 1. A , репрезентативный участок нейтрофилов CD66b + , окрашенных на HLA-DR. B , Доля нейтрофилов, экспрессирующих HLA-DR, у 84 субъектов с активной ВЛ, 20 из этих же субъектов после завершения терапии и 33 контрольных пациентов. * P < 0,001, P < 0,0001. C Нейтрофилы выделяли из лейкоцитов цельной крови субъектов с ВЛ до или после завершения терапии с использованием набора Miltenyi CD66abce MicroBead. Комплементарную ДНК использовали для анализа экспрессии генов с помощью SYBR green с праймерами в таблице 1.Данные показаны для экспрессии HLA-DR относительно β 2 -микроглобулина в качестве эндогенного эталона и нормализованы к средним пороговым значениям цикла для контролей. Статистический анализ был выполнен с парными t тестов (n = 7 пациентов с ВЛ).

    Рисунок 1.

    Обнаружение нейтрофилов, экспрессирующих HLA-DR, в цельной крови субъектов с висцеральным лейшманиозом (ВЛ). Периферическую венозную кровь собирали у субъектов с активной ВН до лечения (ВЛ) или после 28 дней лечения и перед выпиской (Тх).Кровь собирали у здоровых эндемичных контрольных субъектов (продолжение) в течение того же периода. Лейкоциты цельной крови окрашивали для проточной цитометрии и гейтировали нейтрофилы, как показано на дополнительной фигуре 1. A , репрезентативный участок нейтрофилов CD66b + , окрашенных на HLA-DR. B , Доля нейтрофилов, экспрессирующих HLA-DR, у 84 субъектов с активной ВЛ, 20 из этих же субъектов после завершения терапии и 33 контрольных пациентов. * P < .001, P < .0001. C , Нейтрофилы выделяли из лейкоцитов цельной крови субъектов с ВЛ до или после завершения терапии с использованием набора Miltenyi CD66abce MicroBead. Комплементарную ДНК использовали для анализа экспрессии генов с помощью SYBR green с праймерами в таблице 1. Данные показаны для экспрессии HLA-DR относительно β 2 -микроглобулина в качестве эндогенного эталона и нормализованы к средним пороговым значениям цикла для контролей. Статистический анализ был выполнен с парными t тестов (n = 7 пациентов с ВЛ).

    Вдохновленные отчетом о нейтрофилах низкой плотности у пациентов с ВЛ [11], мы задались вопросом, будут ли нейтрофилы HLA-DR + , наблюдаемые у пациентов с ВЛ, очищаться фракцией нейтрофилов низкой плотности. Сначала мы сравнили экспрессию HLA-DR в нейтрофилах CD66b + из фракций лейкоцитов низкой плотности у субъектов во время острой ВЛ, у тех же субъектов после лечения и у эндемичных контролей. Данные, представленные на рисунке 2, подтвердили наблюдение, что высокие доли нейтрофилов CD66b + присутствуют во фракциях с низкой плотностью (РВМС) субъектов с острой ВЛ, но снижаются после лечения.Было подтверждено, что эти клетки являются нейтрофилами при микроскопическом исследовании нейтрофилов, выделенных из фракций низкой плотности (РВМС) с микрогранулами CD66abce. Окрашивание по Райту-Гимзе клеток CD66b + низкой плотности показало типичный внешний вид многодольчатых нейтрофилов (гранулоциты низкой плотности [LDG]; рис. 2 D ). LDG существенно не отличались по внешнему виду от нейтрофилов нормальной плотности, выделенных у того же субъекта (NDG; рисунок 2 D ). Обе фракции включали полосчатые формы, что свидетельствует о сдвиге в сторону раннего высвобождения незрелых форм при острой ВЛ.

    Рисунок 2.

    HLA-DR-экспрессирующие нейтрофилы обогащены фракциями нейтрофилов низкой плотности у субъектов с острым висцеральным лейшманиозом (ВЛ). Кровь собирали у субъектов с ВЛ до (ВЛ) или после лечения (Тх) и у эндемичных здоровых контролей (ЭК). Кровь разделяли методом седиментации по плотности фиколла-гипака и фракции низкой плотности, мигрирующей над слоем фиколла, которая также содержит мононуклеарные клетки периферической крови, и окрашивали для проточной цитометрии. A, B , репрезентативная диаграмма рассеяния ( A ) и гистограмма ( B ) нейтрофилов CD66b + во фракции лейкоцитов низкой плотности (LD). C , Доля нейтрофилов, обнаруженных во фракциях низкой плотности, выделенных из крови 56 субъектов с ВЛ, 16 пациентов с ВЛ, получавших лечение, и 19 контрольных пациентов. * P < 0,01; P < 0,001. D , Микроскопические изображения нейтрофилов, обогащенных фракцией низкой плотности или фракции нормальной плотности пациентов с ВЛ до лечения, с использованием набора CD66abce MicroDead (Militenyi) и окрашенных с помощью набора для окрашивания Diff-Quik (эквивалент Райта-Гимзы; Fisher научный).Сокращения: ЛДГ, гранулоциты низкой плотности; NDGs, гранулоциты нормальной плотности.

    Рисунок 2.

    HLA-DR-экспрессирующие нейтрофилы обогащены фракциями нейтрофилов низкой плотности у субъектов с острым висцеральным лейшманиозом (ВЛ). Кровь собирали у субъектов с ВЛ до (ВЛ) или после лечения (Тх) и у эндемичных здоровых контролей (ЭК). Кровь разделяли методом седиментации по плотности фиколла-гипака и фракции низкой плотности, мигрирующей над слоем фиколла, которая также содержит мононуклеарные клетки периферической крови, и окрашивали для проточной цитометрии. A, B , репрезентативная диаграмма рассеяния ( A ) и гистограмма ( B ) нейтрофилов CD66b + во фракции лейкоцитов низкой плотности (LD). C , Доля нейтрофилов, обнаруженных во фракциях низкой плотности, выделенных из крови 56 субъектов с ВЛ, 16 пациентов с ВЛ, получавших лечение, и 19 контрольных пациентов. * P < 0,01; P < 0,001. D , Микроскопические изображения нейтрофилов, обогащенных фракцией низкой плотности или фракции нормальной плотности пациентов с ВЛ до лечения, с использованием набора CD66abce MicroDead (Militenyi) и окрашенных с помощью набора для окрашивания Diff-Quik (эквивалент Райта-Гимзы; Fisher научный).Сокращения: ЛДГ, гранулоциты низкой плотности; NDGs, гранулоциты нормальной плотности.

    Мы рассчитали абсолютное количество ЛДГ в крови пациентов с ВЛ на основе клинических лабораторных полных клеток крови и дифференциальных подсчетов в сочетании с данными проточной цитометрии. У 22 пациентов была вся доступная информация до и после лечения. Среднее (SD) абсолютное число ЛДГ было в 1,79 (2,38) раза выше у пациентов с ВЛ до терапии, чем после завершения терапии. Хотя стандартное отклонение высокое из-за вариабельности между пациентами, у каждого субъекта было меньше LDG после, чем до терапии.Разница была статистически значимой ( P < 0,003; парный тест t ). Таким образом, как доля, так и количество ЛДГ были значительно выше у пациентов с ВЛ до лечения, чем после лечения ВЛ.

    Эти наблюдения привели нас к скринингу субъектов с ВЛ и контрольной группы на содержание нейтрофилов CD66b + в цельной крови или во фракциях LDG или NDG, экспрессирующих HLA-DR. Эти сравнения показаны на рисунке 3 для 39 пациентов с острым ВЛ, 13 тех же пациентов в день выписки и 13 эндемичных контрольных пациентов.HLA-DR + нейтрофилы были сконцентрированы во фракциях LDG и истощены во фракциях NDG у всех испытуемых, несмотря на резко различающееся у них количество общих HLA-DR + нейтрофилов.

    Рисунок 3.

    HLA-DR-экспрессирующие нейтрофилы обогащены фракциями нейтрофилов низкой плотности у субъектов с острым висцеральным лейшманиозом (ВЛ). Кровь собирали у пациентов с ВЛ до или после успешного лечения. Кровь также собирали у здоровых эндемичных контрольных субъектов.Лейкоциты исследовали в цельной крови или разделяли методом седиментации фиколла на фракции низкой и высокой плотности, содержащие популяции гранулоцитов низкой плотности (LDG) и гранулоцитов нормальной плотности (NDG) соответственно. Образцы окрашивали антителами к человеческому CD66b и HLA-DR и гейтировали на нейтрофилы. A , Репрезентативные графики HLA-DR против CD66b во фракциях LDG 2 субъектов с указанными фенотипами. B , Доли нейтрофилов в каждой фракции (цельная кровь [WB], LDG и NDG), которые окрашиваются положительно на HLA-DR у указанных субъектов.Статистический анализ был выполнен с помощью программного обеспечения GraphPad Prism 7 с использованием однофакторного дисперсионного анализа и посттеста Тьюки (75 субъектов с ВЛ и 33 эндемичных контрольных субъекта). * P < 0,001.

    Рисунок 3.

    HLA-DR-экспрессирующие нейтрофилы обогащены фракциями нейтрофилов низкой плотности у субъектов с острым висцеральным лейшманиозом (ВЛ). Кровь собирали у пациентов с ВЛ до или после успешного лечения. Кровь также собирали у здоровых эндемичных контрольных субъектов.Лейкоциты исследовали в цельной крови или разделяли методом седиментации фиколла на фракции низкой и высокой плотности, содержащие популяции гранулоцитов низкой плотности (LDG) и гранулоцитов нормальной плотности (NDG) соответственно. Образцы окрашивали антителами к человеческому CD66b и HLA-DR и гейтировали на нейтрофилы. A , Репрезентативные графики HLA-DR против CD66b во фракциях LDG 2 субъектов с указанными фенотипами. B , Доли нейтрофилов в каждой фракции (цельная кровь [WB], LDG и NDG), которые окрашиваются положительно на HLA-DR у указанных субъектов.Статистический анализ был выполнен с помощью программного обеспечения GraphPad Prism 7 с использованием однофакторного дисперсионного анализа и посттеста Тьюки (75 субъектов с ВЛ и 33 эндемичных контрольных субъекта). * P < 0,001.

    Экспрессия костимулирующих молекул на HLA-DR+ нейтрофилах

    Мы рассмотрели, экспрессируют ли нейтрофилы HLA-DR + из цельной крови или фракции ЛДГ костимулирующие молекулы, которые также необходимы для презентации антигена. Графики проточной цитометрии показали, что нейтрофилы, экспрессирующие HLA-DR, также экспрессируют как CD80, так и CD86, и разница между нейтрофилами HLA-DR + и HLA-DR во всех фракциях и субъектах была значительной (рис. 4).

    Рисунок 4.

    Костимулирующие молекулы в HLA-DR + по сравнению с HLA-DR нейтрофилов. Периферическую кровь больных висцеральным лейшманиозом (ВЛ) до (ВЛ; n = 11) или в конце лечения (ВЛ Tx; n = 11) или кровь эндемичных здоровых контролей (ЭК; n = 15) исследовали как цельную кровь. или разделены на фракции низкой и нормальной плотности. Образцы окрашивали на CD66b, HLA-DR и либо на CD80, либо на CD86. Нейтрофилы были отобраны на основе свойств рассеяния и окрашивания CD66b, как показано на дополнительном рисунке 1, и было оценено количество окрашивания CD80 или CD86 на нейтрофилах HLA-DR + или HLA-DR .Данные показывают процент нейтрофилов HLA-DR + или HLA-DR во фракциях цельной крови (WB) или гранулоцитов низкой плотности (LDG), которые окрашиваются положительно на CD80 или CD86. Результаты, выраженные в виде среднего геометрического индекса флуоресценции красителя CD80 или CD86, были сходными (не показаны). * P < 0,001, P < 0,0001 (однофакторный дисперсионный анализ).

    Рисунок 4.

    Костимулирующие молекулы в HLA-DR + по сравнению с HLA-DR нейтрофилов.Периферическую кровь больных висцеральным лейшманиозом (ВЛ) до (ВЛ; n = 11) или в конце лечения (ВЛ Tx; n = 11) или кровь эндемичных здоровых контролей (ЭК; n = 15) исследовали как цельную кровь. или разделены на фракции низкой и нормальной плотности. Образцы окрашивали на CD66b, HLA-DR и либо на CD80, либо на CD86. Нейтрофилы были отобраны на основе свойств рассеяния и окрашивания CD66b, как показано на дополнительном рисунке 1, и было оценено количество окрашивания CD80 или CD86 на нейтрофилах HLA-DR + или HLA-DR .Данные показывают процент нейтрофилов HLA-DR + или HLA-DR во фракциях цельной крови (WB) или гранулоцитов низкой плотности (LDG), которые окрашиваются положительно на CD80 или CD86. Результаты, выраженные в виде среднего геометрического индекса флуоресценции красителя CD80 или CD86, были сходными (не показаны). * P < 0,001, P < 0,0001 (однофакторный дисперсионный анализ).

    Примирование и активация нейтрофилов в цельной крови субъектов с VL

    Одной из потенциальных причин нейтрофилов низкой плотности может быть дегрануляция.Поэтому мы определили, проявляют ли нейтрофилы HLA-DR + маркеры прайминга или активации. Нейтрофилы от индивидуумов с ВЛ экспрессировали более высокие уровни CD11b и CD62L с пониженной экспрессией, оба маркера прайминга, по сравнению с эндемичными контролями (Фигура 5 A ). При рассмотрении доли нейтрофилов, экспрессирующих высокий уровень CD11b или низкий уровень CD62L, нейтрофилы HLA-DR + демонстрировали значительно большие признаки активации, чем нейтрофилы HLA-DR в крови пациентов с ВЛ (рис. 5 B ).В соответствии с этими наблюдениями гранулированный тетраспанин CD63, экспонирующийся на поверхности нейтрофилов во время дегрануляции, был более сильно экспрессирован в нейтрофилах пациентов с ВЛ, чем в контрольной группе, а в крови пациентов с ВЛ CD63 + нейтрофилы были обнаружены во фракции ЛДГ (рис. 5 C ). Во фракции LDG окраска CD63 + была значительно более распространена в нейтрофилах HLA-DR + , чем в нейтрофилах HLA-DR ( P 19), не повышалась на поверхности HLA-DR. + нейтрофилов (рис. 5 D ).В совокупности эти данные указывают на то, что подгруппа нейтрофилов у субъектов с активной ВН демонстрирует маркеры активации или праймирования и что активированные нейтрофилы содержатся во фракции ЛДГ. Нейтрофилы HLA-DR + не имеют поверхностных маркеров, что позволяет предположить, что они эквивалентны G-MDSC [10], хотя в некоторых исследованиях MDSC документированы во фракциях крови с низкой плотностью [19].

    Рисунок 5.

    Циркулирующие нейтрофилы от пациентов с висцеральным лейшманиозом (ВЛ) демонстрируют праймированный фенотип. A, B . Образцы цельной крови субъектов с острым VL (n = 38) или здоровых контролей (n = 17) окрашивали на маркеры праймирования/активации. Нейтрофилы CD66b + отбирали путем гейтирования и анализировали с помощью проточной цитометрии на предмет экспрессии ими поверхностных CD62L, CD11b и CD63. Данные представлены в виде средней интенсивности флуоресценции (MFI) для CD62L и CD11b ( A ), а также для процента HLA-DR + или HLA-DR нейтрофилов с высокой экспрессией CD11b или низкой экспрессией CD62L ( B ). ).* P < 0,05. C , Процент нейтрофилов, экспрессирующих CD63, сравнивают между цельной кровью индивидуумов с острой ВЛ и эндемичным здоровым контролем. Цельную кровь лиц с ВЛ разделяли на фракции гранулоцитов нормальной плотности (NDG) и гранулоцитов низкой плотности (LDG), и все фракции окрашивали на поверхностный CD63. P < 0,01; P < 0,0001. D , Нейтрофилы периферической крови 12 субъектов с острой ВЛ окрашивали на CD62L и CD33 либо в виде цельной крови, либо после отделения LDG от NDG.Указан процент нейтрофилов в каждой фракции, окрашивающихся положительно на CD33. Статистический анализ проводили с использованием дисперсионного анализа для 3 фракций или парного теста t при сравнении ВН с контрольными группами или HLA-DR + с HLA-DR нейтрофилов. * P < 0,05.

    Рисунок 5.

    Циркулирующие нейтрофилы пациентов с висцеральным лейшманиозом (ВЛ) имеют праймированный фенотип. A, B . Образцы цельной крови субъектов с острым VL (n = 38) или здоровых контролей (n = 17) окрашивали на маркеры праймирования/активации.Нейтрофилы CD66b + отбирали путем гейтирования и анализировали с помощью проточной цитометрии на предмет экспрессии ими поверхностных CD62L, CD11b и CD63. Данные представлены в виде средней интенсивности флуоресценции (MFI) для CD62L и CD11b ( A ), а также для процента HLA-DR + или HLA-DR нейтрофилов с высокой экспрессией CD11b или низкой экспрессией CD62L ( B ). ). * P < 0,05. C , Процент нейтрофилов, экспрессирующих CD63, сравнивают между цельной кровью индивидуумов с острой ВЛ и эндемичным здоровым контролем.Цельную кровь лиц с ВЛ разделяли на фракции гранулоцитов нормальной плотности (NDG) и гранулоцитов низкой плотности (LDG), и все фракции окрашивали на поверхностный CD63. P < 0,01; P < 0,0001. D , Нейтрофилы периферической крови 12 субъектов с острой ВЛ окрашивали на CD62L и CD33 либо в виде цельной крови, либо после отделения LDG от NDG. Указан процент нейтрофилов в каждой фракции, окрашивающихся положительно на CD33.Статистический анализ проводили с использованием дисперсионного анализа для 3 фракций или парного теста t при сравнении ВН с контрольными группами или HLA-DR + с HLA-DR нейтрофилов. * P < 0,05.

    Влияние гетерологичной плазмы пациентов с ВЛ на нейтрофилы

    Плазма больных ВЛ содержит провоспалительные и противовоспалительные цитокины, которые, как ожидается, будут влиять на функции циркулирующих иммунных клеток [20].Мы исследовали, может ли плазма пациентов с ВЛ повышать уровень HLA-DR нейтрофилов периферической крови. Чтобы проверить это, мы инкубировали цельную кровь здоровых людей с плазмой людей с ВН или без нее перед окрашиванием на поверхностные маркеры. Источниками плазмы были субъекты с активной ВЛ, пациенты с вылеченной ВЛ, гетерологичные здоровые лица и аутологичная плазма. После инкубации при 37°С в 5% диоксиде углерода в течение 24 часов клетки окрашивали на CD66b и HLA-DR и обрабатывали для проточной цитометрии.Данные, суммированные на Фигуре 6 A , показали, что плазма субъектов с активной ВЛ, но не контрольных субъектов, вызывала увеличение HLA-DR на поверхности нейтрофилов здоровых субъектов.

    Рисунок 6.

    Взаимодействие нейтрофилов с другими иммунными элементами in vitro. A , Взаимодействие нейтрофилов с плазмой. Образцы крови здоровых субъектов инкубировали с образцами плазмы субъектов с острым висцеральным лейшманиозом (ВЛ; n = 21), субъектов с пролеченным ВЛ (Tx; n = 12), гетерологичной (гетеро) плазмой здоровых субъектов (n = 8) или аутологичная плазма (Auto) (n = 17) при 37°C и 5% углекислом газе.Через 24 часа клетки окрашивали для проточной цитометрии. На графике показан процент закрытых нейтрофилов с положительной окраской на HLA-DR. B , Фракции лейкоцитов низкой плотности и высокой плотности отделяли по градиенту Ficoll-Hypaque из цельной крови субъектов с ВЛ или эндемичных здоровых контролей. CD15 + нейтрофилов низкой плотности (LDG) и CD3 + Т-клетки отделяли от фракций низкой плотности на гранулах Miltenyi, а оставшиеся клетки низкой плотности обогащали антигенпрезентирующими клетками (АРС).Нейтрофилы нормальной плотности отделяли от лейкоцитов низкой плотности на гранулах CD15 + (NDG). Т-клетки метили CFSE и инкубировали в течение 48 часов с каждой из очищенных фракций лейкоцитов при 37°C, 5% CO 2 в присутствии растворимого антигена Leishmania. Доля пролиферирующих (CFSE-low) Т-клеток в каждом состоянии, обнаруженная с помощью проточной цитометрии, показана на графике. C и D Цельную кровь или очищенные нейтрофилы низкой и нормальной плотности (WB, LDG, NDG соответственно) получали из крови субъектов с ВЛ или из эндемичных здоровых контролей.Эти лейкоциты окрашивали антителами к CD66b, PD1 и PDL1 и анализировали с помощью проточной цитометрии. Ворота для CD66b + нейтрофилов и CD66b лимфоцитов были установлены из графиков прямого/бокового рассеяния и CD66b. Пропорции лимфоцитов от VL или контрольных субъектов, окрашивающихся положительно на PD1, показаны на панели C , а на панели D показаны фракции нейтрофилов, окрашивающиеся положительно на PDL1 в крови субъектов VL. Сокращения: АПК, антигенпрезентирующая клетка; CFSE, сукцинимидиловый эфир карбоксифлуоресцеина; LDG, гранулоцит низкой плотности; NDG, нормальные гранулоциты высокой плотности; PD1, белок запрограммированной гибели клеток-1; PDL1, лиганд-1 запрограммированной гибели клеток; PMNs, полиморфноядерные лейкоциты; ВБ, цельная кровь. А, * Р < 0,05; † P < 0,0001. В, * Р < 0,01. С, Р < 0,003; P < 0,0001.

    Рисунок 6.

    Взаимодействие нейтрофилов с другими иммунными элементами in vitro. A , Взаимодействие нейтрофилов с плазмой. Образцы крови здоровых субъектов инкубировали с образцами плазмы субъектов с острым висцеральным лейшманиозом (ВЛ; n = 21), субъектов с пролеченным ВЛ (Tx; n = 12), гетерологичной (гетеро) плазмой здоровых субъектов (n = 8) или аутологичная плазма (Auto) (n = 17) при 37°C и 5% углекислом газе.Через 24 часа клетки окрашивали для проточной цитометрии. На графике показан процент закрытых нейтрофилов с положительной окраской на HLA-DR. B , Фракции лейкоцитов низкой плотности и высокой плотности отделяли по градиенту Ficoll-Hypaque из цельной крови субъектов с ВЛ или эндемичных здоровых контролей. CD15 + нейтрофилов низкой плотности (LDG) и CD3 + Т-клетки отделяли от фракций низкой плотности на гранулах Miltenyi, а оставшиеся клетки низкой плотности обогащали антигенпрезентирующими клетками (АРС).Нейтрофилы нормальной плотности отделяли от лейкоцитов низкой плотности на гранулах CD15 + (NDG). Т-клетки метили CFSE и инкубировали в течение 48 часов с каждой из очищенных фракций лейкоцитов при 37°C, 5% CO 2 в присутствии растворимого антигена Leishmania. Доля пролиферирующих (CFSE-low) Т-клеток в каждом состоянии, обнаруженная с помощью проточной цитометрии, показана на графике. C и D Цельную кровь или очищенные нейтрофилы низкой и нормальной плотности (WB, LDG, NDG соответственно) получали из крови субъектов с ВЛ или из эндемичных здоровых контролей.Эти лейкоциты окрашивали антителами к CD66b, PD1 и PDL1 и анализировали с помощью проточной цитометрии. Ворота для CD66b + нейтрофилов и CD66b лимфоцитов были установлены из графиков прямого/бокового рассеяния и CD66b. Пропорции лимфоцитов от VL или контрольных субъектов, окрашивающихся положительно на PD1, показаны на панели C , а на панели D показаны фракции нейтрофилов, окрашивающиеся положительно на PDL1 в крови субъектов VL. Сокращения: АПК, антигенпрезентирующая клетка; CFSE, сукцинимидиловый эфир карбоксифлуоресцеина; LDG, гранулоцит низкой плотности; NDG, нормальные гранулоциты высокой плотности; PD1, белок запрограммированной гибели клеток-1; PDL1, лиганд-1 запрограммированной гибели клеток; PMNs, полиморфноядерные лейкоциты; ВБ, цельная кровь. А, * Р < 0,05; † P < 0,0001. В, * Р < 0,01. С, Р < 0,003; P < 0,0001.

    Взаимодействие ЛДГ-Т-клеток

    Результаты предыдущих исследований позволяют предположить, что нейтрофилы, экспрессирующие HLA-DR, могут презентировать антиген Т-клеткам [21]. Напротив, наши исследования, посвященные этой возможности, с использованием нейтрофилов HLA-DR + у субъектов с ВЛ показали, что нейтрофилы, возникающие в этих условиях, могут не стимулировать Т-клеточные ответы (рис. 6 B ).Для этого исследования мы использовали аффинную очистку гранул для фракционирования слоя лейкоцитов низкой плотности на CD3 + T-клеток, CD15 + LDG и оставшиеся клетки, содержащие классические APC. Нейтрофилы нормальной плотности (NDG) выделяли с помощью гранул анти-CD15 из-под фракции фиколла. Т-клетки, меченные сукцинимидиловым эфиром карбоксифлуоресцеина (CFSE), инкубировали в общем растворимом антигене Leishmania плюс буфер (отрицательный контроль), NDG, очищенных LDG или APC, и пролиферацию определяли путем разведения CFSE в дочерних клетках, измеряя с помощью потока цитометрия.Как показано на Фигуре 6 B , единственным условием, при котором пролиферация Т-клеток значительно превышала фоновый уровень, было присутствие антигена и классических АПК. Очевидные различия между Т-клетками без или с NDG или LDG не были статистически значимыми.

    В дополнение к приведенным выше доказательствам отсутствия стимуляции Т-клеток, поверхностные белки, опосредующие истощение Т-клеток, активировались в LDG. Лимфоидные клетки либо в цельной крови, либо во фракции РВМС низкой плотности у субъектов с ВЛ экспрессируют высокие уровни лиганда запрограммированной гибели клеток-1 (PDL1) (рис. 6, C ), что согласуется с нашим предыдущим наблюдением высокой экспрессии PD1 на CD8. + Т-клеток от пациентов с [22].Кроме того, наблюдалось значительное увеличение экспрессии PDL1 на поверхности LDG у пациентов с VL (Фигура 6 D ).

    ОБСУЖДЕНИЕ

    VL приводит к нерегулируемому периферическому воспалительному состоянию с дефектными кожными реакциями гиперчувствительности замедленного типа на антиген Leishmania и неспособностью клеточных реакций контролировать рост паразита [23, 24]. Давнее мнение о том, что неспособность избавиться от ВН является следствием дефекта высвобождения гамма-интерферона (IFN) CD4 + Т-клетками, требует модификации с учетом недавних данных о том, что лимфоциты ведут себя совершенно по-разному в препаратах цельной крови по сравнению с препаратами мононуклеарных клеток [25–25]. 28].Эти данные подчеркивают необходимость дальнейшего анализа клеточных реакций, лежащих в основе воспалительного состояния во время ВЛ человека.

    Исследования на мышиных моделях подчеркивают роль нейтрофилов в лейшманиозе, несмотря на то, что ранее считалось, что эти короткоживущие клетки неспособны поддерживать инфекцию во время хронической протозойной инфекции [6, 29, 30]. Основываясь на гипотезе о том, что нейтрофилы человека также могут участвовать в патогенезе, мы исследовали нейтрофилы у людей с активной ВЛ.Мы сделали неожиданное наблюдение, что подгруппа циркулирующих нейтрофилов экспрессирует маркеры презентации антигена, включая главный комплекс гистосовместимости класса II и костимулирующие молекулы CD80 и CD86 у субъектов с ВЛ. Эти клетки мигрировали во фракцию лейкоцитов периферической крови с низкой плотностью, фракцию, которая содержит мононуклеарные лейкоциты и недавно описанную популяцию ЛДГ, которая лучше всего изучена у пациентов со злокачественными новообразованиями или аутоиммунными заболеваниями [31]. Мы показали, что эти клетки являются нейтрофилами в соответствии с поверхностными маркерами, характерным микроскопическим видом и наличием транскрипта, специфичного для нейтрофилов.Несмотря на то, что у субъектов с ВЛ было низкое количество циркулирующих нейтрофилов, у них было больше ЛДГ до, чем после лечения, и часть из них проявляла некоторую степень активации. Праймированные/активированные и HLA-DR + нейтрофилы мигрировали в низкоплотную фракцию лейкоцитов крови.

    Нейтрофилы низкой плотности, очищающиеся в градиенте плотности с мононуклеарными клетками крови, наблюдались еще в 1986 г. у больных системной красной волчанкой, ревматоидным артритом или острой ревматической лихорадкой.Субпопуляции нейтрофилов, экспрессирующие HLA-DR и другие костимулирующие молекулы, также были обнаружены в синовиальной жидкости или кровообращении у пациентов с ревматоидным артритом или гранулематозом Вегенера, соответственно [12, 13], хотя до настоящего отчета не было показано, что они совпадают с LDG. Транскрипты, специфичные для нейтрофилов, были обнаружены в микрочипах PBMC пациентов с системной красной волчанкой, и их присутствие было подтверждено с помощью иммуногистохимии и микроскопии. Эти LDG активируются и секретируют IFN типа I, фактор некроза опухоли α и IFN-γ, но обладают сниженной способностью к фагоцитозу [9].Сообщается, что ЛДГ у пациентов с септическим шоком экспрессируют аргиназу и дзета-цепь Т-клеточного рецептора (CD247), а количество этих нейтрофилов во фракциях РВМС коррелирует с тяжестью заболевания [31]. Наконец, было обнаружено, что фракции РВМС от эфиопских пациентов с активной ВЛ содержат CD15 + нейтрофилов с высоким уровнем аргиназы. Было высказано предположение, что у этих же субъектов истощение запасов аргинина связано с подавлением активности Т-клеток [11, 32].

    Можно спорить о том, являются ли ЛДГ теми же, что и так называемые G-MDSC, супрессивные миелоидные клетки со свойствами незрелого гранулоцитарного ростка, которые также мигрируют во фракции лейкоцитов низкой плотности [31, 33].Такие клетки можно индуцировать трансформирующим фактором роста-бета, в большом количестве присутствующим в кровотоке лиц с ВЛ [26, 33]. Тем не менее, у нас нет доказательств того, что нейтрофилы HLA-DR + , наблюдаемые при острой ВЛ, имеют тип незрелых клеток и не активируют CD33, как это описано для G-MDSC. Мы демонстрируем доказательства потенциального подавляющего эффекта за счет экспрессии PDL1 у хозяина с высоким уровнем лимфоцитов PD1 + . Вместо того, чтобы находить их такими же, как G-MDSC, мы считаем, что эти клетки добавляют еще один уровень сложности к возможным подмножествам нейтрофилов, наблюдаемым в болезненном состоянии.

    Факторы, вызывающие или усиливающие развитие функционально различных подмножеств нейтрофилов, точно не определены. В одном сообщении предполагается, что нетрадиционные Т-клетки индуцируют дифференцировку нейтрофилов человека в клетки, способные к перекрестной презентации антигена [21], а в других предполагается, что HLA-DR и костимулирующие молекулы индуцируются цитокинами, включая IFN-γ и/или гранулоцитарно-макрофагальные колонии. стимулирующий фактор [34, 35]. Наконец, наши собственные исследования субъектов с кожным лейшманиозом на северо-востоке Бразилии задокументировали присутствие в этом состоянии HLA-DR-экспрессирующих LDG (R.E.D. и др., неопубликованные данные).

    Функциональная роль подмножеств нейтрофилов, в частности нейтрофилов HLA-DR + низкой плотности, неизвестна. Исследования других состояний, проведенные другими исследователями, предполагают, что эти клетки будут способны представлять антиген Т-клеткам в той или иной степени. Наши данные свидетельствуют о том, что нейтрофилы, экспрессирующие HLA-DR, не действуют как APC. Мы проверили данные других авторов о том, что лимфоциты субъектов с ВЛ экспрессируют высокие уровни PD1, а также совершенно новые данные о том, что высокие уровни PDL1 экспрессируются на HLA-DR + низкой плотности, но не на нейтрофилах нормальной плотности.Это приводит нас к гипотезе о том, что HLA-DR-экспрессирующие нейтрофилы, которые становятся заметными во время ВЛ, могут участвовать в истощении Т-клеток, а не в презентации антигена.

    Примечания

    Финансовая поддержка. Эта работа была частично поддержана грантом Исследовательского центра тропической медицины от NIH (P50 AI-074321), NIH (гранты R01 AI076233 и R01 AI045540 для MEW), Департамента по делам ветеранов (гранты 5I01BX001983 и 2I01BX000536), и Совет по научным и промышленным исследованиям.

    Возможные конфликты интересов. Все авторы: Нет сообщений о конфликтах. Все авторы представили форму ICMJE для раскрытия потенциальных конфликтов интересов. Выявлены конфликты, которые редакция считает относящимися к содержанию рукописи.

    Каталожные номера

    1

    Альвар

    Дж

    ,

    Яктайо

    S

    ,

    Берн

    C

    .

    Лейшманиоз и бедность

    .

    Тренды Паразитол

    2006

    ;

    22

    :

    552

    7

    .2

    Шаппюи

    Ф

    ,

    Сундар

    С

    ,

    Хайлу

    А

    и др. .

    Висцеральный лейшманиоз: каковы потребности в диагностике, лечении и контроле?

    Nat Rev Microbiol

    2007

    ;

    5

    :

    873

    82

    .3

    Кай

    Р

    ,

    Скотт

    P

    .

    Лейшманиоз: сложность взаимодействия хозяин-патоген

    .

    Nat Rev Microbiol

    2011

    ;

    9

    :

    604

    15

    .4

    Шармой

    М

    ,

    Megnekou

    R

    ,

    Allenbach

    C

    и др..

    Leishmania major индуцирует различные фенотипы нейтрофилов у мышей, устойчивых или восприимчивых к инфекции

    .

    J Лейкок Биол

    2007

    ;

    82

    :

    288

    99

    .5

    Харрелл

    БП

    ,

    Regli

    IB

    ,

    Tacchini-Cottier

    F

    .

    Различные виды Leishmania управляют разными функциями нейтрофилов

    .

    Тренды Паразитол

    2016

    .6

    Харрелл

    БП

    ,

    Schuster

    S

    ,

    Grun

    E

    и др. .

    Быстрая секвестрация Leishmania mexicana нейтрофилами способствует развитию хронического поражения

    .

    PLoS Pathog

    2015

    ;

    11

    :

    e1004929

    .7

    Рибейро-Гомиш

    FL

    ,

    Peters

    NC

    ,

    Debrabant

    A

    ,

    Мешки

    DL

    .

    Эффективный захват инфицированных нейтрофилов дендритными клетками кожи подавляет ранний ответ против Leishmania

    .

    PLoS Pathog

    2012

    ;

    8

    :

    e1002536

    .8

    Пикар

    Х

    ,

    Muschel

    RJ

    ,

    Opdenakker

    G

    .

    О двойной роли и поляризованных фенотипах нейтрофилов в развитии и прогрессии опухоли

    .

    Crit Rev Oncol Hematol

    2012

    ;

    82

    :

    296

    309

    .9

    Денни

    МФ

    ,

    Yalavarthi

    S

    ,

    Zhao

    W

    и др..

    Отдельная подгруппа провоспалительных нейтрофилов, выделенных у пациентов с системной красной волчанкой, вызывает повреждение сосудов и синтезирует интерфероны I типа

    .

    J Иммунол

    2010

    ;

    184

    :

    3284

    97

    .10

    Юн

    СО

    ,

    Коллазо

    М

    ,

    Шалова

    ИН

    ,

    Бисвас

    СК

    ,

    Габрилович

    ДИ

    .

    Характеристика природы гранулоцитарных супрессорных клеток миелоидного происхождения у мышей с опухолями

    .

    J Лейкок Биол

    2012

    ;

    91

    :

    167

    81

    .11

    Абебе

    Т

    ,

    Такеле

    Y

    ,

    Weldegebreal

    T

    и др. .

    Активность аргиназы — маркер статуса заболевания у пациентов с висцеральным лейшманиозом в Эфиопии

    .

    PLoS Negl Trop Dis

    2013

    ;

    7

    :

    e2134

    .12

    Икинг-Конерт

    С

    ,

    VOGT

    S

    ,

    S

    ,

    Radsak

    M

    ,

    Wagner

    C

    ,

    Hansch

    GM

    ,

    andrassy

    k

    .

    Полиморфноядерные нейтрофилы при гранулематозе Вегенера приобретают характеристики антигенпрезентирующих клеток

    .

    Почки Int

    2001

    ;

    60

    :

    2247

    62

    .13

    Крест

    А

    .

    Нейтрофилы синовиальной жидкости транскрибируют и экспрессируют молекулы главного комплекса гистосовместимости класса II при ревматоидном артрите

    .

    Ревматоидный артрит

    2003

    ;

    48

    :

    2796

    806

    .14

    Икинг-Конерт

    С

    ,

    CSeko

    C

    ,

    Wagner

    C

    ,

    STEGMAIER

    S

    ,

    andrassy

    K

    ,

    Hansch

    GM

    .

    Трансдифференцировка полиморфноядерных нейтрофилов: приобретение CD83 и других функциональных характеристик дендритных клеток

    .

    J Mol Med (Берл)

    2001

    ;

    79

    :

    464

    74

    .15

    Радсак

    М

    ,

    Iking-Konert

    C

    ,

    Stegmaier

    S

    ,

    Andrassy

    K

    ,

    Hansch

    GM

    .

    Полиморфноядерные нейтрофилы в качестве вспомогательных клеток для активации Т-клеток: главный комплекс гистосовместимости класса II ограничивает антиген-зависимую индукцию пролиферации Т-клеток

    .

    Иммунология

    2000

    ;

    101

    :

    521

    30

    .16

    Пирсон

    РД

    ,

    Ромито

    R

    ,

    Саймс

    PH

    ,

    Харкус

    JL

    .

    Взаимодействие промастигот Leishmania donovani с макрофагами, происходящими из моноцитов человека: проникновение паразита, внутриклеточное выживание и размножение

    .

    Infect Immun

    1981

    ;

    32

    :

    1249

    53

    .17

    Бора

    Д

    .

    Эпидемиология висцерального лейшманиоза в Индии

    .

    Natl Med J India

    1999

    ;

    12

    :

    62

    8

    .18

    Сундар

    С

    ,

    Чакраварти

    Дж

    .

    Лейшманиоз: обновление современной фармакотерапии

    .

    Экспертное заключение фармацевта

    2013

    ;

    14

    :

    53

    63

    .19

    Пошке

    я

    ,

    Кисслинг

    Р

    .

    О вооружении и внешнем виде супрессорных клеток миелоидного происхождения человека

    .

    Клин Иммунол

    2012

    ;

    144

    :

    250

    68

    .20

    Мухопадхьяй

    Д

    ,

    DAS

    NK

    ,

    ROY

    S

    ,

    Kundu

    S

    ,

    S

    ,

    Barbhuya

    JN

    ,

    Chatterjee

    M

    .

    Милтефозин эффективно модулирует цитокиновую среду при индийском посткалаазарском кожном лейшманиозе

    .

    J Infect Dis

    2011

    ;

    204

    :

    1427

    36

    .21

    Дэйви

    МС

    ,

    Morgan

    MP

    ,

    Liuzzi

    AR

    и др. .

    Микроб-специфические нетрадиционные Т-клетки индуцируют дифференцировку нейтрофилов человека в клетки, перекрестно представляющие антиген

    .

    J Иммунол

    2014

    ;

    193

    :

    3704

    16

    .22

    Гаутам

    С

    ,

    Кумар

    Р

    ,

    Сингх

    Н

    и др..

    Истощение клеток CD8T при висцеральном лейшманиозе человека

    .

    J Infect Dis

    2014

    ;

    209

    :

    290

    9

    .23

    Джеронимо

    СМ

    ,

    Дуггал

    П

    ,

    Браз

    РФ

    и др. .

    Появляющаяся пригородная картина заражения Leishmania chagasi, простейшим, вызывающим висцеральный лейшманиоз на северо-востоке Бразилии

    .

    Scand J Infect Dis

    2004

    ;

    36

    :

    443

    9

    .24

    Хепнер Леви

    л

    ,

    Мендес

    E

    .

    Нарушение клеточного иммунитета у больных кала-азаром

    .

    Аллергол Иммунопатол (Мадр)

    1981

    ;

    9

    :

    109

    12

    .25

    Карвалью

    ЭМ

    ,

    Badaro

    R

    ,

    Reed

    SG

    ,

    Jones

    TC

    ,

    Johnson

    WD

    Jr.

    Отсутствие продукции гамма-интерферона и интерлейкина 2 при активном висцеральном лейшманиозе

    .

    Дж Клин Инвест.

    1985

    ;

    76

    :

    2066

    9

    .26

    Уилсон

    МЭ

    ,

    Джеронимо

    СМ

    ,

    Пирсон

    РД

    .

    Иммунопатогенез инфекции висцерализирующим Leishmania видов

    .

    Микроб Патог.

    2005

    ;

    38

    :

    147

    60

    .27

    Хо

    М

    ,

    Koech

    DK

    ,

    Iha

    DW

    ,

    Bryceson

    AD

    .

    Иммуносупрессия при кенийском висцеральном лейшманиозе

    .

    Clin Exp Immunol

    1983

    ;

    51

    :

    207

    14

    .28

    Кумар

    Р

    ,

    Singh

    N

    ,

    Gautam

    S

    и др. .

    Специфичные для Leishmania клетки CD4T выделяют IFNgamma, который ограничивает репликацию паразита у пациентов с висцеральным лейшманиозом

    .

    PLoS Negl Trop Dis

    2014

    ;

    8

    :

    e3198

    .29

    Петерс

    НЗ

    ,

    Egen

    JG

    ,

    Secundino

    N

    и др..

    Визуализация in vivo показывает важную роль нейтрофилов в лейшманиозе, передающемся москитами

    .

    Наука

    2008

    ;

    321

    :

    970

    4

    .30

    Тальхофер

    КДЖ

    ,

    Чен

    Y

    ,

    Судан

    B

    ,

    Love-Homan

    L

    ,

    Wilson

    ME

    .

    Лейкоциты инфильтрируют кожу и дренируют лимфатические узлы в ответ на простейшие Leishmania infantum chagasi

    .

    Infect Immun

    2011

    ;

    79

    :

    108

    17

    .31

    Дарси

    КДЖ

    ,

    Minigo

    G

    ,

    Piera

    KA

    и др. .

    Нейтрофилы с супрессорной функцией миелоидного происхождения истощают запасы аргинина и ограничивают функцию Т-клеток у пациентов с септическим шоком

    .

    Crit Care

    2014

    ;

    18

    :

    R163

    .32

    Такеле

    Д

    ,

    Абебе

    T

    ,

    Weldegebreal

    T

    и др. .

    Активность аргиназы в крови больных висцеральным лейшманиозом и ВИЧ-инфекцией

    .

    PLoS Negl Trop Dis

    2013

    ;

    7

    :

    e1977

    .33

    Пиллэй

    Дж

    ,

    Так

    Т

    ,

    Камп

    ВМ

    ,

    Коендерман

    Л

    .

    Иммунная супрессия нейтрофилами и гранулоцитарными клетками-супрессорами миелоидного происхождения: сходства и различия

    .

    Cell Mol Life Sci

    2013

    ;

    70

    :

    3813

    27

    .34

    Сандилендс

    ГП

    ,

    McCrae

    J

    ,

    Hill

    K

    ,

    Perry

    M

    ,

    Baxter

    D

    .

    Антиген главного комплекса гистосовместимости класса II (DR) и костимулирующие молекулы на активированных in vitro и in vivo полиморфно-ядерных нейтрофилах человека

    .

    Иммунология

    2006

    ;

    119

    :

    562

    71

    .35

    Фангер

    нет данных

    ,

    Liu

    C

    ,

    Guyre

    PM

    и др. .

    Активация человеческих Т-клеток главным комплексом гистосовместимости класса II, экспрессирующим нейтрофилы: пролиферация в присутствии суперантигена, но не столбнячного анатоксина

    .

    Кровь

    1997

    ;

    89

    :

    4128

    35

    .

    Примечания автора

    Опубликовано издательством Oxford University Press для Американского общества инфекционистов в 2016 г. Эта работа написана (а) служащими правительства США и является общественным достоянием в США

    .

    Похожие записи

    При гормональном сбое можно ли похудеть: как похудеть при гормональном сбое

    Содержание Как похудеть после гормональных таблетокЧто такое гормональные таблеткиПочему прием гормонов ведет к избыточному весу (adsbygoogle = window.adsbygoogle || []).push({}); […]

    Гипотензивные средства при гиперкалиемии: Гипотензивные средства при гиперкалиемии — Давление и всё о нём

    Содержание Препараты, применяемые для лечения гипертонической болезни | Илларионова Т.С., Стуров Н.В., Чельцов В.В.Основные принципы антигипертензивной терапииКлассификация Агонисты имидазолиновых I1–рецепторов […]

    Прикорм таблица детей до года: Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственном

    Содержание Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственномКогда можно и нужно вводить прикорм грудничку?Почему […]

    Добавить комментарий

    Ваш адрес email не будет опубликован.