Как сделать тест правильно: Проверка на точность / Мой кроха и Я

alexxlab Разное

Содержание

Врач рассказал, когда лучше делать тест на коронавирус — Российская газета

ПЦР-тест будет наиболее точен на третий-пятый день с момента появления симптомов коронавируса, а экспресс-тест на антиген можно делать с первого дня появления симптомов и до пятого-седьмого дня, после этого концентрация вируса будет резко снижаться. Об этом «Российской газете» рассказал главный врач Центра диагностики и лечения им. Н. А. Семашко Заур Жилоков.

Тест обязательно нужно сдать, если симптомы заболевания появились у людей старше 65 лет или у человека с хроническими заболеваниями, например, с сахарным диабетом, хронической почечной недостаточностью и прочими. Его стоит пройти после посещения массовых мероприятий, возвращения домой после поездок и перелетов, контакта с человеком, у которого подтвердился COVID-19.

Врач напомнил, что основными симптомами коронавируса считаются температура, заложенность носа, потеря обоняния и вкуса, слабость и кашель. У 20% заболевших наблюдаются затруднение дыхания и одышка.

«Самостоятельно определить, заразились ли вы ковидом или обычным гриппом очень сложно — симптомы практически одинаковы, — говорит Жилоков. — Иногда их можно списать на банальную аллергию, простуду, переутомление».

Он также подчеркнул, что за три часа до сдачи теста не стоит пить, есть, полоскать горло и пользоваться какими-либо спреями и каплями. При выборе теста врач рекомендовал обращать внимание на специфичность и чувствительность, которые выражаются в процентах. Специфичность — доля тех отрицательных результатов, которые были правильно идентифицированы. Иными словами, с какой вероятностью тест не среагирует на другой схожий тип вируса. Высокоспецифичные тесты редко дают ложноположительные результаты. При этом остается небольшая вероятность, что они могут пропустить заболевание с легким течением, недостаточно ярко выраженное. Чувствительность — это точность теста в определении антигена вируса. Это вероятность того, что тест не допустит ошибку и не покажет ложноотрицательный результат при наличии болезни.

Как сделать тест на ковид в домашних условиях: виды тестов

Прежде, чем приступить к процедуре по взятию мазка, нужно ознакомиться с мерами предосторожности. К ним относятся такие шаги:

  1. Тест нельзя использовать, если срок годности закончился.
  2. Не принимать пищу, напитки и не курить в месте проведения теста. Комната должна быть чистой.
  3. Если упаковка повредилась, тест лучше заменить на новый — целый.
  4. Пользоваться нужно только тем, что входит в комплект для тестирования.
  5. Соблюдайте последовательно и четко процедуру. Важно проводить заборы образцов правильно, как указано в инструкции.
  6. Несоблюдение процедуры может привести к неточным результатам.
  7. Обращаться с образцами следует как с потенциально инфицированным материалом. Соблюдайте стерильность, вымойте руки до и после процедуры. 
  8. В случае, если забор проводит другой человек, ему/ей следует надеть одноразовые перчатки и защитную маску.
  9. Когда все завершится, тест и использованные комплектующие следует вложить в полиэтиленовый пакет и выбросить в контейнер для отходов.

Как провести тест?

Перед тем, как провести тест на ковид, нужно взять мазок. Забирать образец из носоглотки нужно таким образом: 

  1. Опрокиньте голову назад на 45-70°.
  2. Не торопясь, легким движением руки введите кончик стерильного тампона в ноздрю и продвигайте его по внешней стенке носа параллельно небу примерно на глубину 5 см. Для детей достаточно глубины на 3 см. Вы должны почувствовать сопротивление соприкосновения задней стенки носоглотки.
  3. Когда вы почувствуете, что материал упирается о заднюю стенку носоглотки, начинайте аккуратно выполнять вращательные движения тампоном внутри в течение нескольких секунд — этого достаточно, чтобы тампон пропитался секретом.
  4. Медленно вращая, достаньте тампон из носовой полости. 

Что важно еще знать: тестирование следует выполнять как можно быстрее после забора образца. На тот случай, если быстро выполнить процедуру не представляется возможным, поместите тампон с образцом в сухую стерильную и плотно закрытую пробирку для хранения. Тогда образец может храниться в течение 8 часов при комнатной температуре и 24 часа при температуре 2-8°C.

Чтобы правильно подготовить и сохранить образец мазка, нужно:

  1. открутить крышку пробирки с буфером;
  2. вставить стерильный тампон в пробирку с буфером;
  3. вращать тампон примерно в течение 10 секунд, одновременно прижимая тампон к внутренней стенке пробирки;
  4. затем убрать тампон, выжимая его. Нужно сжимать стенки пробирки для того, чтобы получить максимальное количество жидкости из тампона;
  5. плотно закрыть пробирку крышкой. 

А теперь переходим к самому тестированию!

Процедура тестирования проводится таким образом:

  1. Для этого нужно приготовить все необходимые для тестирования материалы: часы, тест-кассету, стерильный тампон, пробирку с буфером и образцом. Материалы строго те, что находятся в комплекте.
  2. Убедитесь, что они комнатной температуры.
  3. Откройте запаянный пакет, достаньте тест-кассету из упаковки и используйте в течение одного часа. 
  4. Лучший результат можно получить, если провести тестирование сразу после открытия упаковки.
  5. Положите тест-кассету на чистую и ровную поверхность.
  6. Открутите верхушку крышки пробирки с образцом, переверните ее и внесите 3 капли полученной смеси в окошко кассеты, обозначенное буквой (S). 
  7. Засеките время.
  8. Учет результата проведите через 15 минут.
  9. Не берите во внимание результаты тестирования позже, чем через 20 минут.

Расшифровка результата

О том, что тест положительный, скажут появившиеся две цветные линии. Одна цветная линия должна появиться в контрольной зоне (C), а  другая — в тестовой (T). Положительный результат указывает на наличие антигенов или антител в образце.

Отрицательный: одна цветная линия появляется в контрольной зоне (C). Линии в тестовой зоне не будет.

Недействителен: контрольная линия не появляется вообще. Причиной такого результата может быть недостаточное количество исследуемого образца, несоблюдение процедуры тестирования, сроков годности и условий хранения быстрых тестов. В таком случае нужно использовать другую тест-кассету, убедившись, что все меры предосторожности и правила соблюдаются.

Сегодня разрабатывается более 200 вакцин от коронавируса, а некоторые из них уже активно применяются во многих странах. Но какая считается самой лучшей по эффективности и безопасности? Узнайте, какая вакцина от коронавируса лидирует: здесь сравнение CoronaVac, Pfizer, Moderna и Johnson & Johnson.

Вопрос о вакцинации в Украине стоит очень остро. Население старается выработать иммунитет за счет самых популярных и топовых вакцин. Но ни одно средство не может гарантировать 100%-ный результат. Читайте подробнее о том, по каким причинам вакцина может вовсе не проявить себя.

Узнавайте больше о здоровье на apteka24.ua.

 

Данный редакционный материал прошел проверку на достоверность семейным врачом Первой Мобильной клиники Украины «DobroDoc+» — Дерий Натальей Валентиновной.

 

Источники

Interpreting Diagnostic Tests for SARS-CoV-2  / JAMA

Age- and Sex-Associated Variations in the Sensitivity of Serological Tests Among Individuals Infected With SARS-CoV-2 / JAMA

Coronavirus (COVID-19) Update: FDA Authorizes Antigen Test as First Over-the-Counter Fully At-Home Diagnostic Test for COVID-19 / FDA

Robust T cell immunity in convalescent individuals with asymptomatic or mild COVID-19 / Biorxiv

 

Отказ от ответственности

apteka24.ua предоставляет исчерпывающую и надежную информацию по вопросам медицины, здоровья и благополучия, однако постановка диагноза и выбор методики лечения могут осуществляться только вашим лечащим врачом! Самолечение может быть небезопасным для вашего здоровья. apteka24.ua не несет ответственности за возможные негативные последствия, возникшие в результате использования пользователями apteka24.ua информации, размещенной на сайте.

Создание тестов | Справка Blackboard


Страница «Новый тест»

Присвойте тесту информативный заголовок, чтобы учащиеся могли легко найти его в материалах курса. На странице Материалы курса заголовок отображается в виде ссылки, по которой учащиеся могут просмотреть материалы. Если вы не добавите заголовок, в списке содержимого появится пункт «Новый тест» и дата. Если вы не добавите содержимое, тест не отобразится на странице Материалы курса.

Добавление вопросов и других элементов. Нажмите значок плюса, чтобы открыть меню, и сделайте выбор. Можно выбрать тип вопроса, добавить пул вопросов или повторно использовать вопросы и содержимое из существующих оцениваний. Вы также можете добавить файлы и текст, такие как инструкции к тесту. Кроме того, можно добавлять файлы из облачного хранилища, например OneDrive

® и Google Диска™. Включить параллельное оценивание для теста с вопросами невозможно.

Подробнее о добавлении вопросов

Подробнее о добавлении пулов вопросов

Подробнее о повторно используемых вопросах и содержимом оценивания

Добавление дополнительного содержимого. После добавления вопроса в тест вы можете выбрать, нужно ли учащимся добавлять дополнительное содержимое, например текст, вспомогательные файлы или вложения. По умолчанию эта функция включена для вашего теста. Если вы не хотите, чтобы учащиеся добавляли дополнительное содержимое, отключите эту функцию. 

Отображение и скрытие теста. Учащиеся не видят тест, пока вы не решите его отобразить. Вы можете создать все содержимое заранее и выбрать элементы, которые необходимо показать учащимся согласно вашему расписанию. Кроме того, можно установить условия доступности на основании даты, времени и результатов выполнения других элементов в журнале оценок курса. На странице Материалы курса учащиеся могут узнать, когда вы установили тест для отображения.

Применение настроек теста. Щелкните значок Настройки, чтобы открыть панель, на которой вы предоставляете подробные сведения о задании.

Укажите дату выполнения. Сроки выполнения отображаются в календаре и на ленте активности. Просроченные отправки отображаются с меткой Просроченная в журнале оценок курса. Порекомендуйте учащимся просматривать сроки выполнения текущих и следующих заданий и задавать вопросы как можно раньше.

Просматривайте дополнительные возможности. Можно установить дополнительные возможности для учащихся, чтобы освободить их от некоторых требований курса, таких как сроки выполнения теста и временные ограничения. Для выбора дополнительных возможностей перейдите к списку участников и откройте меню учащегося. Количество выбранных дополнительных возможностей отображается на странице заданий в разделе Настройки теста.

Подробнее о дополнительных возможностях

Добавление ограничений по времени. Временной предел помогает учащимся сосредоточиться на тесте, поскольку они имеют ограниченное количество времени для его сдачи. Попытки прохождения теста автоматически сохраняются и отправляются по истечении времени. Можно также разрешить учащимся работать после превышения временного предела. В настоящее время добавить временной предел для групповых тестов невозможно.

Разрешить беседы на занятии. Если вы включили возможность бесед для теста, учащиеся могут обсуждать доступный тест с вами и своими сокурсниками. Учащиеся могут принимать участие в обсуждении до, во время и после теста. Каждая беседа отображается только для соответствующего теста.

Подробнее о беседах

Сбор отправляемых материалов в автономном режиме. Возможно, вам понадобится оценить работу учащегося, которая не требует загрузки отправленного материала. Например, вы можете добавлять оценки в свой журнал оценок для устных презентаций, проектов по ярмарке знаний и умений, актерских представлений и художественного творчества в режиме персональных сообщений.

Подробнее о сборе отправляемых материалов в автономном режиме

Вывод вопросов и ответов в случайном порядке. Вопросы и ответы на них можно отображать в случайном порядке с целью развития практических навыков и предотвращения академической нечестности среди учащихся. Вы можете использовать одну или обе настройки, чтобы тесты для каждого учащегося выглядели по-разному. Вывести вопросы в случайном порядке в тестах, содержащих текстовые блоки или вложения, невозможно.

Вывод ответов в случайном порядке возможен только для вопроса с запросом установить соответствие и вопросов с вариантами ответов. Если вы хотите использовать случайные ответы для вопросов «верно/неверно», используйте тип «Вопрос с множественным выбором» с вариантами ответа «верно» и «неверно».

Вопросы для вас отображаются в постоянном порядке, а для учащихся — в случайном. Чтобы предотвратить путаницу, не добавляйте номера для ссылки на другие вопросы в рамках теста.

Подробнее о выводе вопросов и ответов в случайном порядке

Изменение категории оценки. Категорию оценки можно изменить и внести ее в категории пользовательского журнала оценок, которые вы установили в своем курсе. Можно создавать категории, чтобы систематизировать работу курса, как вам требуется. При выставлении общей оценки для курса можно использовать как стандартные, так и настраиваемые категории.

Определение числа попыток. Вы можете предоставить учащимся несколько попыток для одного теста. Если разрешено несколько попыток, вы также можете выбрать способ расчета итоговой оценки. В настоящее время добавить несколько попыток для группового теста невозможно.

Выбор схемы оценок. В меню Способ оценки выберите существующую схему оценок, например Баллы. Результат за тест представляет собой итоговую сумму баллов, начисленных за все вопросы. Вы можете в любой момент изменить схему оценок. Изменения будут показаны учащимся, а также отображены в вашем журнале оценок.

При создании теста, включающего только блоки текста, вы можете вручную установить максимальное количество баллов.

Включение анонимного оценивания. Если вы создаете тест без вопросов, можно включить анонимное оценивание, чтобы во время оценивания имена учащихся были скрыты. В анонимно оцениваемые тесты можно добавлять только текст и файлы.

Подробнее об анонимном оценивании

Отображение результатов оценивания. Установите флажок Отобразить верные ответы, чтобы учащиеся могли видеть правильные ответы на автоматически оцениваемые вопросы после их отправки.

Подробнее об отображении правильных ответов

Включение автоматического отзыва. Оставьте автоматический отзыв о работах учащихся на основе ваших настроек.

Подробнее об автоматических отзывах

Предоставление кода доступа. Вы можете выпустить код доступа, чтобы контролировать, когда учащиеся или группы сдают тесты. Сейчас система генерирует коды случайным образом. Вы не можете изменять коды доступа

Подробнее о кодах доступа

Включение параллельного оценивания. Включить параллельное оценивание и назначить оценщиков можно при создании теста без вопросов. Вы можете включить параллельное оценивание даже после отправки работ учащимися. Система произвольно назначает выбираемых вами оценщиков, чтобы тест каждого учащегося оценивали два оценщика. Рабочая нагрузка по оцениванию распределяется равномерно между оценщиками. Оценщики могут открывать отправленные материалы только назначенных им учащихся. Итоговую оценку для учащегося определяет преподаватель или согласователь.

Подробнее о параллельном оценивании

Добавление набора критериев. Наборы критериев могут помочь при оценивании отправленных учащимися материалов на основе определенных вами основных критериев. На странице Настройки теста можно создать набор критериев или связать уже созданный. На данном этапе вы можете только добавить набор критериев к тесту без вопросов.

Добавление целей и стандартов. Вы можете сопоставлять тест с одной или несколькими целями. С помощью целей ваше учреждение и вы можете оценивать достижения учащихся в рамках программ и учебных планов. Кроме того, можно сопоставить с целями отдельные вопросы теста.

Создание группового теста. Можно создать тест для групп учащихся. По умолчанию оценки назначаются каждой группе в целом, но вы можете изменить оценку отдельного участника группы.

Групповые тесты создаются так же, как и групповые задания.

Включение SafeAssign. Вы можете использовать SafeAssign для проверки отправленных материалов учащихся на наличие плагиата. Вы можете включить отчет SafeAssign Originality Report в любое время (даже после начала отправки учащимися своих материалов), но отправленные материалы проверяются только при включенном SafeAssign.

Добавление описания (при необходимости). Описание отображается на странице Материалы курса вместе с заголовком теста. Вы можете попросить учащихся добавить файлы в конце своих тестов. Например, вы можете попросить их предоставить ссылки на источники для открытых вопросов, включить лабораторные работы или подготовить содержимое перед тестом.

Тест на беременность: Как правильно использовать?

Когда у женщины задержка, первым делом хочется точно знать – а не беременна ли она? И ты спешишь в аптеку, покупаешь тест на беременность и… Стоп, а ты точно знаешь, что с ним нужно делать?

Современные тесты на беременность очень просты в использовании. При условии следования инструкции, надежность теста составляет около 99%.

Тест занимает всего несколько минут. Для того, чтобы его выполнить, необходимо поместить несколько капель мочи на специальную полоску, пропитанную определенным химическим веществом, или же поместить полоску мод струю мочи. Полоска определяет наличие гормона – хорионического гонадотропина человека (ХГЧ).

ХГЧ вырабатывается плацентой, если женщина беременна. Данный гормон отвечает также за проявление некоторых первых симптомов беременности, например, чувствительность груди и тошноту.

Уровень ХГЧ, как правило, можно зафиксировать в моче приблизительно через 10 дней после оплодотворения. Если сделать тест на беременность в домашних условиях ранее, чем через 10 дней после зачатия, тест может дать ложноотрицательный результат. То есть, в таком случае тест может показать негативный результат при фактической беременности.

Специалисты советуют женщинам выполнять тест через 5-10 дней после окончания менструального цикла для того, чтобы повысить точность. Если тест показывает отрицательный результат, подожди несколько дней. Если менструация не начнется, выполни тест еще раз, и при необходимости обратись к врачу. Не все тесты на беременность одинаково точны, некоторые могут определить даже очень низкий уровень ХГЧ в моче, другие – нет. Тест может зафиксировать беременность на ранней стадии, если он определяет достаточно низкий уровень ХГЧ.

При выполнении теста на беременность в домашних условиях следуй советам:

– Если возможно, для проведения теста используй первую утреннюю мочу (когда уровень ХГЧ определить наиболее легко). Если это невозможно, используй ту мочу, которая пробыла в мочевом пузыре минимум 4 часа.

– Перед проведением теста не пей большое количество жидкости для увеличения количества мочи. Излишняя жидкость разбавит мочу и снизит уровень ХГЧ.

– Перед проведением теста внимательно прочтите инструкцию и следуйте ее указаниям.

– Некоторые препараты для повышения уровня фертильности (и другие препараты) могут влиять на результаты теста. Более детальная информация должна быть указана на упаковке теста или в его инструкции.

В случае каких-либо отклонений при беременности, например, внематочной беременности (когда оплодотворенная яйцеклетка остается в фаллопиевой трубе, не попадая в матку), уровень ХГЧ бывает низок и его невозможно определить. Если ты не уверенна относительно результатов теста, обратись к врачу.

Читай также: Первые признаки беременности

Читайте Ivona.ua в Google News

Быстрый тест на антиген | Быстрые тесты на коронавирус

Тест на антиген является одним из тестов, применяемых при диагностике коронавируса. Недавно Всемирная организация здравоохранения (ВОЗ) одобрила антигенные тесты для диагностики ОРВИ-CoV-2. На данный момент рекомендуется подтвердить отрицательные результаты с помощью генетического теста.

Cодержание:

1. Тест на антиген коронавируса — что это?

2. Тест-система для теста на антиген COVID-19

3. Тест на Коронавирусный антиген — когда тестировать?

4. Сколько времени нужно для получения результатов теста на антиген?

1. Тест на антиген коронавируса — что это?

Тест на антиген позволяет быстро и качественно выявить антиген SARS-CoV-2 в образцах мазка из носа или носоглотки (в зависимости от типа теста) и позволяет установить предварительный диагноз COVID-19. Нельзя считать отрицательный результат исключением инфекции SARS-CoV-2. Тест на антиген применяется благодаря возможности получить результат быстрее, чем в случае классического теста ПЦР (примерно 10-30 минут против, как правило, 24 часов).

Тест на антиген COVID — как он работает?

Тест на антиген в носоглоточном материале обнаруживает вирусоспецифические белки, образующиеся при его репликации, в отличие от ПЦР-тестов, которые позволяют выявить вирусный генетический материал в образце. В настоящее время ВОЗ позволила проводить антигенные тесты в случае ограниченной доступности генетических тестов (молекулярных, то есть RT-PCR и FRANKD) или когда время, необходимое для их проведения, ограничивает их клиническую пользу.

Одобренные ВОЗ антигенные тесты должны иметь чувствительность ≥ 80% и специфичность ≥ 97%. На данный момент рекомендуется проверять как положительные, так и отрицательные результаты с помощью молекулярного теста (RT-PCR, PCR).

2. Тест-система для теста на антиген COVID-19

Тест проводится подобно тестам ПЦР на основе мазка, взятого из носа или носоглотки пациента (в зависимости от теста). После взятия мазка образец материала помещают в отверстие на опытной пластине и через определенное время считывают. Время выполнения варьируется между тестами поставщиков, но обычно результат доступен через 10-30 минут.

3. Тест на Коронавирусный антиген — когда тестировать?

Проведение теста на антиген ограничивается начальной стадией заболевания — до 5-7 дней после появления симптомов, свидетельствующих о COVID-19, поскольку именно тогда вирус интенсивно реплицируется (то есть размножается). Нет данных для оценки использования этого теста в бессимптомных популяциях. На поздних стадиях COVID-19 концентрация вируса может снижаться, и тесты могут не обнаружить его присутствия.

4. Сколько времени нужно для получения результатов теста на антиген?

Большим преимуществом антигенных тестов является время их проведения, которое гораздо короче (примерно 10-30 минут), чем у рекомендованного ВОЗ классического теста RT-PCR (обычно 24 часа). Антигенный тест на заражение ОРВИ-CoV-2 позволяет быстро идентифицировать инфицированных людей за короткое время.

Источники:

1. Министерство здравоохранения Украины, «Информация о коронавирус»: https://moz.gov.ua/koronavirus-2019-ncov

2. Официальный информационный портал Кабинета Министров Украины: https://covid19.gov.ua/

3. Всемирная организация здравоохранения: https://www.who.int/emergencies/diseases/novel-coronavirus-2019/advice-for-public

ПРОЦЕДУРА ТЕСТИРОВАНИЯ НА ВИЧ – ИНФЕКЦИЮ

 

Кому нужны тесты на ВИЧ?

ВИЧ — это вирус. В отличие от людей, вирусы не знают, что такое дискриминация. Вирусу безразличен пол, возраст, социальное положение и сексуальная ориентация — все, что нужно ВИЧ — это возможность проникнуть в организм. Не существует «групп риска», существуют ситуации, которые являются потенциально опасными с точки зрения передачи ВИЧ:
  • — Вагинальный или анальный секс без презерватива.
  • — Инъекционный прием наркотиков при помощи иглы, шприца или посуды, которыми ранее пользовались другие люди.

Если вас беспокоит возможность передачи ВИЧ, то до обращения в кабинет тестирования вам может потребоваться информация о риске заражения, а также о самих тестах.

 

Зачем идти в кабинет тестирования?

Люди решают пройти тестирование на ВИЧ по самым разным причинам:

— Знание о своем положительном ВИЧ-статусе может помочь людям вовремя получить медицинскую помощь, которая способна предотвратить серьезные и угрожающие жизни заболевания. Например, при наличии ВИЧ-инфекции некоторые инфекции, например сифилис, должны лечиться по-другому. Также при наличии ВИЧ очень важно следить за иммунным статусом и другими показателями, что позволяет вовремя назначить необходимое противовирусное лечение, и предотвратить развитие СПИДа.

— Знание об отсутствии у себя инфекции, может помочь человеку принять решение о том, как сделать свое поведение наиболее безопасным в отношении ВИЧ. Также для человека может быть важно, знать о наличии у себя ВИЧ, так как его волнует безопасность сексуального партнера.

— Диагностика ВИЧ-инфекции позволяет предотвратить передачу ВИЧ ребенку во время беременности.

— Для некоторых людей знание о своем ВИЧ-статусе, пусть даже положительном, может быть менее страшным, чем постоянное беспокойство и навязчивые мысли о возможном заражении. В любом случае, сдача анализа позволяет положить конец мучительной неопределенности, и принимать решения о своей дальнейшей жизни на основе знаний о состоянии своего здоровья.

 

Причины отказа от тестирования

У человека также могут быть причины для того, чтобы не сдавать тест. Он может быть уверен, что в его жизни не было рискованных в отношении ВИЧ ситуаций. Также у человека могут быть более личные причины для отказа от теста. Для многих людей стресс, вызванный знанием о ВИЧ-инфекции, а также возможное влияние диагноза на отношения с окружающими и образ жизни может быть гораздо более пугающим, чем незнание ВИЧ-статуса. Некоторые люди опасаются разглашения тайны диагноза. Также они могут беспокоиться о возможной дискриминации, с которой приходиться сталкиваться ВИЧ-положительным людям.

Подобные вопросы беспокоят большинство людей. Каждый самостоятельно решает, что для него важнее: страх возможного диагноза или преимущества тестирования на ВИЧ. В подобной ситуации человеку может потребоваться консультирование, или обращение на телефон доверия, где ему помогут в принятии решения. Достижения и прогресс медицины в области лечения ВИЧ-инфекции являются главным доводом в пользу теста на ВИЧ. Из истории эпидемии СПИДа давно известно, что чем шире доступ к медицинскому уходу и препаратам для лечения ВИЧ-инфекции, тем большее количество людей принимают решение о тестировании на ВИЧ. Принимая решение сделать анализ, стоит подумать о том, какие возможности есть у человека после получения положительного результата. Будет ли ему предоставлено консультирование и психологическая поддержка? Сможет ли он обратиться на специализированный телефон доверия? Есть ли в его городе группы поддержки и взаимопомощи, а также другие ресурсы для ВИЧ-положительных?

 

Если ВИЧ-инфекция неизлечима и вакцины не существует, есть ли смысл узнавать о том, что у тебя ВИЧ?

Даже если у человека есть ВИЧ, он может позаботиться о том, чтобы сохранить свое здоровье. Хотя на сегодняшний день невозможно полностью избавить человека от ВИЧ, существуют способы замедлить развитие ВИЧ-инфекции, а также излечить или предотвратить опасные заболевания.

 

Если был риск заражения ВИЧ, когда можно сделать тест?

Иммуноферментный анализ (ИФА), который используется для диагностики ВИЧ, может показать результат только через несколько недель после инфицирования. Данный тип анализа определяет не сам вирус, а антитела к нему. У некоторых людей антитела присутствуют в крови в достаточном количестве уже через 2 недели. Тем не менее, у большинства образование антител (сероконверсия) занимает больше времени. Чтобы результат теста был достаточно достоверен, необходимо, чтобы прошло около 3 месяцев после рискованной ситуации. После 3 месяцев тест ИФА достоверен у 95-98% людей, то есть у подавляющего большинства. Иногда образование антител занимает больше времени — от 3 до 6 месяцев.

 

Если результат теста отрицательный через 3 месяца, обязательно ли делать повторный тест через 6 месяцев?

У подавляющего большинства людей тест вполне достоверен через 3 месяца (у большинства антитела появляются еще раньше). Можно полностью исключить возможность заражения, сдав анализ через 6 месяцев. Тем не менее, для многих людей ожидание результатов теста является очень тяжелым переживанием. Если у человека не было очень рискованных контактов с заведомо ВИЧ — положительным партнером, то вероятность, что он окажется среди тех немногих людей, чей тест недостоверен через 3 месяца ничтожно мала. Учитывая стресс, с которым связано тестирование в повторном тесте часто нет необходимости. Тем не менее, окончательное решение все равно остается за человеком.

 

Как долго нужно ждать результатов теста?

Результат анализа, как правило, готов через 3 рабочих дня. Учитывая, что ожидание результатов может быть весьма неприятным периодом, лучше всего уточнить этот вопрос заранее, до сдачи анализа. Также можно узнать, не повлияют ли на сроки теста выходные дни и праздничные дни.

 

Где лучше сделать тест?

Тестирование на ВИЧ – инфекцию должно обязательно сопровождаться процедурой до – и послетестового консультирования, в процессе которых пациент получает достоверную информацию о ВИЧ – инфекции, обсуждает с консультантом индивидуальный риск инфицирования и пути снижения рисков, получает ответы на все интересующие вопросы, касаемые процедуры теста на ВИЧ.

Тестирование бывает двух видов: конфиденциальное и анонимное. Если вы делаете тест конфиденциально, то сотрудникам лаборатории будет известно ваше имя, но следует учесть, что они не могут сообщить его куда-либо, так как это будет нарушением врачебной тайны. В анонимных кабинетах тестирования вы не сообщаете своего имени, а вам присваивается номер или имя по которым вы сможете узнать результат теста.

 

Пройти тестирование на ВИЧ — инфекцию вы можете в любом филиале Удмуртского республиканского СПИД – центра, а также в консультативной поликлинике по адресам:

 

Консультативная поликлиника Удмуртского СПИД – центра: г. Ижевск, ул. Труда, 17а,

e-mail: Этот e-mail адрес защищен от спам-ботов, для его просмотра у Вас должен быть включен Javascript . Телефон: 8(3412) 21-15- 94, 21-35-94, 21-37-86

Сарапульский зональный центр СПИД: г. Сарапул, ул. Гагарина, 67, лит. «Д».

(34147)3-27-43, e-mail: Этот e-mail адрес защищен от спам-ботов, для его просмотра у Вас должен быть включен Javascript .

Воткинский зональный центр СПИД: г. Воткинск, ул. Школьная, 2.

(34145)3-36-23, e-mail: Этот e-mail адрес защищен от спам-ботов, для его просмотра у Вас должен быть включен Javascript .

Можгинский зональный центр СПИД: г. Можга, ул. Сюгаильская, 19.

(34139)3-26-65, e-mail: Этот e-mail адрес защищен от спам-ботов, для его просмотра у Вас должен быть включен Javascript .

Игринский зональный центр СПИД: пос. Игра, ул. Милиционная, 6.

(34134)4-04-85, e-mail: Этот e-mail адрес защищен от спам-ботов, для его просмотра у Вас должен быть включен Javascript .

Глазовский зональный центр СПИД: г. Глазов, ул. Кирова, 27, лит «Л».

(34141)3-37-07, e-mail: Этот e-mail адрес защищен от спам-ботов, для его просмотра у Вас должен быть включен Javascript .

Увинский зональный центр СПИД: пос. Ува, ул. Чкалова, 20.

(34130)5-28-19, e-mail: Этот e-mail адрес защищен от спам-ботов, для его просмотра у Вас должен быть включен Javascript .

 

Если результат отрицательный, значит больше волноваться не надо?

Если тест был сделан через достаточный период времени, в течение которого у вас не было опасных контактов, это значит, вы ВИЧ — отрицательны. Тем не менее, тестирование на ВИЧ и профилактика — это не одно и то же. Недостаточно просто регулярно сдавать анализ, если ваше поведение остается рискованным, то через какое-то время результат теста может оказаться положительным. По счастью, пути передачи ВИЧ изучены лучше, чем у любого другого вируса. Получение отрицательного результата — это хороший повод узнать как можно больше о профилактике ВИЧ, и принять решение о том, как снизить для себя риск заражения.

 

Насколько достоверен положительный результат теста?

Иногда у ИФА бывают ложноположительные результаты (примерно в 1% случаев), причиной подобного результата может быть беременность, различные вирусные инфекции, а также простая случайность. После получения положительного результата необходим более точный тест — иммуноблот, по результатам которого и ставится диагноз. Положительный результат иммуноблота после положительного ИФА достоверен на 99,9% — это максимальная точность для любого медицинского теста. Если иммуноблот отрицательный, значит, первый тест был ложноположительным, и на самом деле ВИЧ у человека нет.

 

Что такое неопределенный результат?

Если ИФА бывает положительным или отрицательным, то иммуноблот может быть положительным, отрицательным или неопределенным. Неопределенный результат иммуноблота, т.е. наличие в иммуноблоте хотя бы одного белка к вирусу, может наблюдаться, если заражение произошло недавно и в крови еще мало антител к ВИЧ, в этом случае иммуноблот станет положительным через некоторое время. Также неопределенный результат может появиться при отсутствии ВИЧ-инфекции при гепатите, некоторых хронических заболеваниях обменного характера, или при беременности. В этом случае, либо иммуноблот станет отрицательным, либо будет обнаружена причина неопределенного результата.

 

Есть ли тест, который можно сделать раньше?

Диагностика ВИЧ-инфекции производиться только с помощью тестов, определяющих антитела. Помимо этого есть тест полимеразной цепной реакции (ПЦР), который определяет генетический материал самого вируса, поэтому он достаточно достоверен через 10 дней после возможного заражения. Иногда люди делают тест ПЦР, т. к. для них тяжело ждать 3 месяца, в других случаях его может назначить врач, например, его делают детям, рожденным от ВИЧ — положительных матерей. Тем не менее, несмотря на высокую чувствительность и надежность, были зафиксированы случаи ложноположительных и ложноотрицательных результатов ПЦР. По этой причине, даже если был сделан ПЦР, может понадобиться подтверждающее тестирование методом ИФА.

 

Если мой партнер сделал тест на ВИЧ, зачем делать тест мне?

Результат теста партнера не всегда говорит о вашем статусе. У вашего партнера может быть ВИЧ, при этом вы могли остаться ВИЧ — отрицательным даже после опасного секса. Также при отсутствии ВИЧ у постоянного сексуального партнера, вирус мог передаться вам во время других случаев рискованного поведения. Если речь идет о стабильных отношениях, то зачастую тестирование рекомендуется обоим партнером одновременно.

 

Что делать, если результат теста отрицательный, но до сих пор есть симптомы?

Прежде всего, обратитесь к врачу по поводу всех своих симптомов. Их причиной может быть все, что угодно помимо ВИЧ-инфекции. Единственным достоверным способом диагностики ВИЧ является тестирование. Даже опытный врач не может определить ВИЧ-инфекцию по симптомам. Если прошло уже достаточно времени и результат повторного анализа отрицательный, то у вас нет ВИЧ, независимо от наличия или отсутствия симптомов. Тем не менее, подобные переживания могут быть симптомом СПИДофобии, и в этом случае следует уделить больше внимания своему психологическому здоровью.

 

Что делать, если все-таки будет обнаружен ВИЧ?

Следует помнить, что ВИЧ и СПИД — это не одно и то же. Если у вас обнаружат ВИЧ, это значит, что в вашем теле присутствует вирус, от которого на данный момент вы не сможете полностью избавиться. СПИД — это лишь одна из стадий ВИЧ-инфекции, во время которой у людей действительно начинаются серьезные проблемы со здоровьем, тем не менее, существуют медикаменты, которые способны замедлить развитие ВИЧ-инфекции и избавить человека от СПИДа. У большинства людей, живущих с ВИЧ, не наблюдается никаких симптомов, они могут продолжать вести привычный образ жизни. Тем не менее, диагноз ВИЧ-инфекция может привести к психологическим проблемам, человеку может потребоваться много времени, чтобы научиться жить с ВИЧ.

 

Материал подготовлен с использованием информации портала http://aids.ru/

Как правильно и быстро сдать ПЦР-тест в Перми? Простая и понятная инструкция

Вирус мутирует, ПЦР уже не справляется!

Это один из самых распространенных мифов последних месяцев: с появлением штамма «Дельта» в сети все чаще говорят о бесполезности тестов, но это не так. ПЦР-тест действительно не отличает РНК вируса (британский или индийский штамм), при этом точно помогает понять, присутствует или нет РНК коронавируса в клетках.

Если говорить простыми словами: мазок остается главным и быстрым способом определения наличия коронавирусной инфекции в организме. Процесс доведен до автоматизма, а результат больше не придется ждать по пять дней, как это было в самом начале пандемии. Главное перед подготовкой к процедуре учесть рекомендации специалистов, чтобы получить точный результат.

Что нужно учесть перед сдачей ПЦР-теста?

Обычно здоровые граждане обращаются для сдачи ПЦР-теста с профилактической целью: до или после поездок за границу, для допуска на работу, плановой госпитализации, участия в массовых мероприятиях. Во всех этих случаях очень важны сроки сдачи. Чаще всего, требуется тест, который сдан не ранее, чем за 72 часа до начала мероприятия. То есть, должно пройти не более 72 часов с момента забора мазка, а не получения результата.

Как подготовиться к процедуре?

Специалисты рекомендуют за два часа до сдачи ПЦР-теста не есть, не пить, не курить и не чистить зубы. Это необходимо для получения достоверного результата.

Можно ли употреблять алкоголь перед взятием анализа?

Медики считают, что лучше не употреблять алкоголь. «Возможное влияние обусловлено больше механическим (простое смывание), чем антисептическим действием. К тому же алкоголь может вызывать снижение неспецифической защиты организма», — говорит эксперт лаборатории ООО «Центр профессиональной медицины», работающей в сотрудничестве с ООО «Профессорская клиника».

Сколько времени занимает сама процедура?

Перед процедурой в течение 5–10 минут проводится оформление необходимых документов. Специалист лаборатории должен заполнить вашу медицинскую карту, договор, информированное согласие, согласие на обработку персональных данных. После этого процедура забора мазка отнимет еще 5–10 минут вашего времени.

Как проходит сдача ПЦР-анализа?

Специалист берет два мазка: один из носоглотки, другой — из ротоглотки (зева). При этом он должен брать мазки сухими стерильными зондами. При заборе анализа из носа зонд помещают в полость носа на глубину 3–4 см у детей и 5–6 см у взрослых. Мазок с задней стенки глотки берется с поверхности миндалин и за ними. После этого оба мазка помещают в одну пробирку для большей концентрации вируса и точности результата.

Насколько он точный?

В конце прошлого года в средствах массовой информации распространялись сведения о том, что 30–40% тестов ПЦР на COVID-19 могут показывать неверные результаты. Однако это совсем не так — в тех же материалах уточнялось, что проблема заключалась не в качестве тестов, а в соблюдении методики тестирования.

Чувствительность и специфичность ПЦР-тестов, зарегистрированных в РФ очень высокая. Ложноотрицательные (человек болен, но тест не выявил наличие РНК) и ложноположительные (человек здоров, но тест показал положительный результат) результаты встречаются довольно редко. Обнаружение РНК вируса COVID-19 напрямую зависит от особенностей течения заболевания (локализации вируса в организме человека, эффективности терапии, состояния общего и местного иммунитета и другие), а также от факторов, связанных с забором материала и проведением исследования (соблюдение методик забора и исследования, длительность и условия транспортировки).

Поэтому важно доверить эту процедуру грамотным специалистам.

Что делают специалисты для получения точного результата?

В лаборатории «Центра профессиональной медицины» действует отработанная система внутреннего контроля качества. Кроме того, лаборатория ежегодно принимает участие в федеральной системе внешней оценки качества исследований. Сотрудники лаборатории — высококвалифицированные специалисты, в том числе и с учеными степенями. Оборудование для исследований периодически проходит проверки, обеспечивающие точность измерений.

Как и в большинстве лабораторий, в «Центре профессиональной медицины» установлено специальное программное обеспечение — лабораторная информационная система (ЛИС). «Перепутать» пробирку невозможно, так как при регистрации специалисты ставят на контейнер штрих-код. При выполнении исследований идентификация материала проводится по штрихкоду. Это позволяет избежать ошибок, связанных с влиянием человеческого фактора.

При исследованиях используются контрольные пробы с положительным и отрицательным результатами. Результаты каждого исследования врач утверждает, только убедившись в его верном контроле.

Передаются ли результаты тестов в Роспотребнадзор?

В Роспотребнадзор передаются сведения о положительных результатах и персональные данные пациентов, у которых выявлен РНК вируса. Это необходимо для проведения оперативных противоэпидемических мероприятий.

Как долго придется ждать результат анализа?

Обязательным требованием к работе ПЦР-лабораторий является соблюдение сроков выполнения исследований. Клиенты должны получить результаты анализа в срок, не превышающий 48 часов после доставки в лабораторию. Заборный пункт «Центра профессиональной медицины» находится в «Профессорской клинике» по адресу: ул. Дружбы 15а. «У нас обычный срок выполнения исследования в рабочие дни не превышает 24 часа. Если материал сдается до 12:00, то результат готов в тот же день», — отмечает эксперт.

Готовые протоколы исследования можно получить по электронной почте (для этого при обращении необходимо правильно указать адрес) или получить в печатном варианте в регистратуре.

В настоящее время можно получить результат через портал Госуслуги. Для этого при обращении надо внести в информированное согласие паспортные данные и номер СНИЛС. После готовности результата сведения передаются на портал Госуслуг, формируется QR-код, с которым можно посещать культурные и спортивные мероприятия. Код действует 72–96 часов с момента сдачи ПЦР-теста.

Какую клинику в Перми лучше выбрать?

В Перми работает несколько медицинских клиник, в которых вы можете узнать, инфицированы ли коронавирусом. Они предоставляют результаты ПЦР в течение 48 или 72 часов. Чтобы быстрее узнать результат своего ПЦР-теста, обратитесь в «Профессорскую клинику» — здесь его предоставят в течение суток.

Как выбрать и пройти тест на COVID-19 дома — клиника Кливленда

Если вы чувствуете першение в горле или приступы кашля, легко заподозрить, что вы могли заразиться COVID-19. В дополнение к тому, чтобы держаться подальше от друзей и семьи, на всякий случай, еще один способ обрести душевное спокойствие — сдать тест на COVID-19 дома.

Cleveland Clinic — некоммерческий академический медицинский центр. Реклама на нашем сайте помогает поддерживать нашу миссию.Мы не поддерживаем продукты или услуги, не принадлежащие Cleveland Clinic. Политика

Однако доступно несколько вариантов, которые могут сбивать с толку. Тем не менее, читайте дальше, как микробиолог и патологоанатом Дэниел Роудс, доктор медицины, объясняет, как выбрать и пройти домашний тест на COVID-19.

Как выбрать тест на COVID-19

Существует два основных типа домашних тестов, одобренных Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) в соответствии с разрешением на использование в чрезвычайных ситуациях (EUA).

Наиболее распространенным является тест на антиген, который определяет, есть ли у вас специфические белки (или антигены), связанные с вирусом SARS-COV-2. Молекулярные тесты, которые могут идентифицировать генетический материал, также доступны.

Лабораторный анализ полимеразной цепной реакции (ПЦР), который вы можете получить у своего поставщика медицинских услуг, также является молекулярным тестом. Тест ПЦР также определяет, есть ли у вас генетический материал, связанный с вирусом SARS-COV-2.

Так как есть разные варианты, Dr.Роудс предлагает сначала определить, чего вы надеетесь достичь, пройдя тест. «Я всегда призываю всех начинать с цели», — говорит он. «Ваша цель — экранизация? Это для диагностики? Если есть симптомы, и вы пытаетесь подтвердить, что у вас инфекция, независимо от того, какой тест вы используете, как вы собираетесь это интерпретировать?»

Результаты домашних тестов на антигены считаются точными, хотя ПЦР-тесты обычно более чувствительны к присутствию вируса в организме. Однако точность домашних тестов зависит от нескольких факторов.К ним относятся, правильно ли вы получили свой образец и когда вы его тестировали. Например, если вы проводите тестирование вскоре после заражения, вы можете не сразу получить положительный результат.

«Если вы получите положительный результат, это, вероятно, действительно положительный результат», — говорит доктор Роудс. «Предостережение в том, что эти тесты на антигены не так чувствительны, как тест ПЦР. Так что если вы плохо себя чувствуете, а тест отрицательный, это не значит, что у вас нет COVID». Доктор Роадс рекомендует следовать рекомендациям CDC о том, как интерпретировать результат теста на антиген, если вы не уверены, что лучше.

Действия при сдаче домашнего теста на COVID-19

Если вы впервые проходите домашний тест на COVID-19, волнение или страх — это нормально. Кроме того, не всегда приятно вставлять мазок в нос для сбора образца слизи.

Лучшим руководством для всех этих тестов является «следуйте вкладышу в упаковку» для каждого отдельного теста, который вы проходите, говорит доктор Роудс. Каждый домашний тест имеет немного разные направления и работает по-разному.

Например, некоторые домашние тесты рекомендуют так называемое серийное тестирование или более одного теста в течение определенного периода времени. «Некоторые из них советуют пройти один тест сейчас, а затем второй тест через несколько часов или дней», — говорит доктор Роудс. «FDA, вероятно, включило это, потому что признает, что они не так чувствительны, как тесты ПЦР».

Несмотря на то, что домашние тесты предлагают пошаговые инструкции по их проведению, вы можете побеспокоиться о том, чтобы правильно следовать инструкциям.К счастью, есть ресурсы, доступные для вас. Если вы купили тест в аптеке, вы можете обратиться за помощью к фармацевту. Ваш лечащий врач также может дать вам советы.

Видео, созданные специально производителем тестов, также являются хорошим ресурсом. Например, у домашнего теста Ellume COVID-19 есть приложение, которое поможет вам пройти через процесс тестирования. Просто не смотрите видео для одного теста и не предполагайте, что оно подходит для всех тестов. «Если у производителя есть видео, следуйте ему», — говорит доктор.Роудс предостерегает. «Вы не хотите использовать тест одного производителя и смотреть видео другого. Это только создаст путаницу».

Нужно ли брать мазок из горла на COVID-19?

Как правило, во многих тестах на COVID-19 вы берете мазок из носа, чтобы получить образец жидкости организма для тестирования. Но вы, возможно, читали новостные статьи, в которых рекомендовалось брать мазок из горла перед носом при проведении домашнего теста.

Одной из причин этого является то, что нерецензируемое исследование показало, что омикронный штамм COVID-19 может вызывать появление большего количества вируса в ваших бронхах, пути, который помогает попадать воздуху в легкие.В результате люди решили, что мазок из горла может выявить наличие у вас COVID-19 раньше. Однако это исследование все еще находится на рассмотрении и не должно считаться фактическим руководством.

Кроме того, некоторые экспресс-тесты в Великобритании также предписывают вам брать мазки из горла и носа как часть процесса. К сожалению, это не относится к экспресс-тестам на COVID-19, которые в настоящее время одобрены в соответствии с EUA FDA США.

«Вы не сможете сделать мазок из горла, потому что FDA не санкционировало ни один из тестов для этого метода», — сказал доктор.— говорит Роудс. «Управление по санитарному надзору за качеством пищевых продуктов и медикаментов не так оценивало их эффективность. И это не их предназначение».

Доктор Роадс добавляет, что необходимы дополнительные исследования, прежде чем мазок из горла можно будет использовать в домашних тестах на COVID-19. «Кто-то должен провести исследование», — говорит он. «Вы не уверены, какое выступление сейчас, без этого. У вас могут быть ложные срабатывания. На самом деле тест может быть не таким чувствительным».

Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США соглашается и прямо заявляет: «У нас пока нет данных, указывающих на то, что мазки из горла являются точным или подходящим методом для домашних тестов.

Однако есть одно место, где можно использовать мазок из горла, чтобы определить, есть ли у вас COVID-19: кабинет вашего врача.

«Некоторые тесты, которые мы проводим в лаборатории, разрешены для мазков из горла, — говорит доктор Роадс. «Мы подтвердили это. Компании подтвердили это. Существуют проверенные методы для мазков из горла. Но я не знаю ни одного безрецептурного теста, который можно было бы провести дома с этим типом образца».

Что делать с результатами домашнего теста на COVID-19

Если у вас положительный результат теста на COVID-19, вам также может быть непонятно, что делать дальше.Изоляция от других членов вашей семьи, чтобы они не заболели, — хороший первый шаг. Вам также следует связаться со всеми людьми, с которыми вы недавно были рядом, чтобы они знали и проверили (или поместили в карантин), если это необходимо.

Тем не менее, в первую очередь вы можете захотеть повторить тест, либо с помощью другого домашнего теста, либо запланировав ПЦР-тест, просто чтобы убедиться, что результаты верны. Доктор Роадс говорит, что в этом нет ничего плохого, хотя это и не требуется. «Если вы получите положительный результат теста, вы можете пойти и пройти подтверждающий тест», — говорит он.«Но я не думаю, что вам нужно повторное тестирование. Это не обязательно».

Однако, по крайней мере, д-р Роадс подчеркивает, что вы должны задокументировать положительный результат теста. В некоторых городах или штатах есть места, где вы можете самостоятельно сообщить о положительном диагнозе в отделы общественного здравоохранения. Для некоторых видов домашних тестов также есть приложение, которое подключается к вашим медицинским записям. Вы также можете документировать результаты самостоятельно с помощью мобильного телефона.

«Сфотографируйте результат теста, если он положительный, чтобы его можно было передать в электронном виде, если вам понадобится медицинская помощь в будущем», — сказал доктор.Роудс советует. «Иногда амбулаторные рецепты могут быть основаны на том, был ли у вас положительный результат. Человеку, который хочет прописать вам лекарство, полезно увидеть это своими глазами и убедиться в этом. И я считаю, что тест на антиген будет адекватным способом документально подтвердить, что у вас есть COVID».

Прежде всего, сообщите об этом своему поставщику медицинских услуг и оставайтесь с ним на связи. Например, MyChart клиники Кливленда позволяет загружать документы, чтобы вы могли загрузить фотографию своего положительного домашнего теста.Особенно, если вы начинаете чувствовать себя хуже или неясно, был ли результат вашего теста правильным, ваш врач может быть отличным ресурсом и помочь вам предпринять следующие шаги, чтобы вернуться на путь к здоровью.

Как сделать экспресс-тест бокового потока на коронавирус (COVID-19)

Быстрый тест бокового потока показывает результат на устройстве, которое поставляется с тестом

Есть отдельная информация о том, как сделать тест ПЦР, тест, который отправляется в лабораторию для получения результатов.

Информация:

Быстрые тесты бокового потока требуют:

  • мазок из зева и носа
  • только мазок из носа

Тест, который у вас есть, может отличаться от того, который вы делали раньше, поэтому важно внимательно прочитать инструкции, прежде чем выполнять контрольная работа.

Если вам нужна помощь в прохождении теста

Посмотрите видео и найдите пошаговые инструкции по прохождению теста, включая удобную для чтения и переведенную версию: GOV.Великобритания: как сделать экспресс-тест на COVID-19 в домашних условиях

Вы можете позвонить по номеру 119 (бесплатно с мобильных и стационарных телефонов), если вам нужна дополнительная поддержка. Линии открыты каждый день с 7:00 до 23:00. 119 обеспечивает поддержку на 200 языках.

SignVideo — это бесплатная онлайн-служба переводчика британского языка жестов для 119.

Вы можете использовать бесплатное приложение Be My Eyes, чтобы получить помощь от обученного персонала NHS Test and Trace. Загрузите приложение, перейдите на страницу Specialized Help и выберите NHS Test & Trace в категории Personal Health .

Если у вас серьезная потеря зрения, возможно, вам будет проще обратиться за помощью в проведении теста к другу или члену семьи.

Оставьте отзыв о своем тестовом наборе или сообщите о повреждении

Если какая-либо часть вашего тестового набора повреждена или отсутствует, не используйте его. Вам нужно будет использовать другой тестовый набор.

Если вы пострадали или у вас возникла реакция при использовании набора для тестирования, сообщите об этом как можно скорее.

Узнайте, как оставить отзыв о своем тест-наборе или сообщить о вреде в GOV.ВЕЛИКОБРИТАНИЯ.

Основные этапы проведения экспресс-теста на боковой поток

Перед взятием мазка:

  • прочтите инструкции в наборе для тестов
  • вымойте руки с мылом или используйте дезинфицирующее средство для рук
  • разложите все предметы из набора для тестов на чистой поверхности
  • если ваш тест не приходите с предварительно заполненной пробиркой, наполните пробирку предоставленной жидкостью и закройте крышку
  • поместите пробирку в держатель пробирок
  • высморкайтесь
  • снова вымойте руки

Взятие мазка

Если ваш тест требуется мазок из горла:

  • широко откройте рот и проведите мазком по миндалинам (или там, где они должны быть).Не касайтесь кончиком тампона зубов, языка и десен
  • . Используйте тот же тампон, протрите внутреннюю часть носа, как указано в инструкциях к тест-набору

. тампон для протирания внутренней части носа, как указано в инструкциях к тест-набору

Завершение теста:

  • поместите конец тампона в пробирку так, чтобы он оказался в жидкости
  • выдавите жидкость из пробирки на тест-полоска
  • проверьте время ожидания в инструкциях к тест-набору
  • подождите время, указанное в инструкции к тест-набору инструкции к тестовому набору, так как это может повлиять на результат.

    Сообщение о вашем результате

    Сообщайте о своем результате, будь то положительный, отрицательный или недействительный, каждый раз, когда вы проводите экспресс-тест NHS на боковой поток.

    Сообщите о результатах экспресс-теста NHS на боковой поток на сайте GOV.UK.

    Проведение теста на ком-то еще

    Если вы проводите тест на ком-то еще, это может помочь:

    • рассказать ему о шагах
    • постараться сохранять спокойствие
    • попросите другого человека помочь вам

    Если ваш тест требует, чтобы вы взяли мазок из горла у кого-то еще:

    • используйте фонарик, чтобы увидеть его миндалины
    • попросите его громко сказать «аааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааааа». человек становится несчастным.

      Важно использовать отдельный набор тестов для каждого человека.

      Важный

      Если вы делаете мазок из горла и носа у кого-то другого и не можете взять мазок из горла, вместо этого вы можете взять мазок из обеих ноздрей.

      Последняя проверка страницы: 14 апреля 2022 г.
      Дата следующего рассмотрения: 28 апреля 2022 г.

      Какой тест на COVID-19 вам следует пройти? > Новости > Yale Medicine

      Если у вас жар, кашель, затрудненное дыхание или другие симптомы COVID-19, вам следует пройти тестирование независимо от статуса вакцинации, советуют эксперты в области здравоохранения.Если тестирование доступно, рассмотрите возможность тестирования через три-пять дней после контакта с высоким риском, добавляет доктор Кэмпбелл.

      Решить, какой тип теста пройти, может быть непросто.

      «Многое здесь зависит от доступа и того, что вам доступно. Мы благодарны за быстрые тесты на антигены, но если у вас нет симптомов, их чувствительность ограничена, и мы знаем, что 40% людей, заразившихся COVID, не имеют симптомов», — говорит доктор Мартинелло. «Тест МАНК более чувствителен, но многое еще зависит от качества образца.”

      Тем не менее, для диагностики тяжелобольных людей (с предполагаемым случаем COVID-19) врачи обычно используют ПЦР-тест, поскольку ложноотрицательные результаты могут привести к неадекватному лечению.

      Путешествие

      Если вы путешествуете, вам также может потребоваться пройти тестирование. Место, которое вы посещаете, может потребовать определенного типа теста и утвержденных мест тестирования.

      «Я думаю, что тест, который вы можете пройти, имеет смысл для путешествий прямо сейчас.Если вы можете сделать ПЦР, прекрасно. Если нет, получите антиген», — говорит доктор Кэмпбелл. «Но вы хотите провести тест, потому что не хотите быть единственным человеком, который заражает всех остальных в самолете».

      Школа и рабочие места

      В школах могут быть свои правила проведения тестирования на COVID-19. Но для эпиднадзора, например, в школах или на рабочих местах, тесты на антигены работают хорошо, говорит доктор Кэмпбелл.

      «Предположим, вы постоянно тестируете детей в школе два раза в неделю.Вы можете сделать это намного быстрее, проще и с меньшими затратами, если будете использовать тесты на антигены», — говорит он. «Вы хотите ответить на вопрос, заразны ли сейчас дети или нет. Будет ли ПЦР лучше в этом случае? Да, но вы не обязательно получите ответ через день, и вы потратите много денег, чтобы найти несколько положительных моментов. Иногда скорость важнее всего».

      Общее спокойствие

      Некоторые люди могут захотеть делать регулярные тесты на COVID для душевного спокойствия.Скажем, вы вакцинированы, но планируете посетить многолюдное мероприятие, а затем навестить родственника с ослабленным иммунитетом или пожилого человека.

      «Если вы собираетесь сделать что-то рискованное, а затем навестить свою 90-летнюю маму, то вам действительно нужно проверить до события и убедиться, что вирус распространяете не вы», — говорит он. .

      После этого сроки дальнейших действий усложняются.

      «Если вы пришли на многолюдный концерт и беспокоитесь о COVID, вы не хотите сдавать на следующий день ни один тест на COVID — молекулярный или антигенный.Вы должны подождать от трех до пяти дней после потенциального воздействия», — говорит доктор Кэмпбелл. «Мы думаем, что у вас должно быть достаточное количество вируса, чтобы быть заразным для других, и мы знаем, что в процессе заражения вирусная нагрузка то увеличивается, то снижается».

      Если у вас есть ограниченное количество тестов, вы должны использовать их непосредственно перед посещением уязвимых друзей или родственников или прямо перед тем, как пойти на мероприятие с большим количеством людей, добавляет доктор Кэмпбелл. «Используйте их, чтобы предотвратить распространение инфекции», — говорит он.

      Насколько точны домашние тесты на Covid? Вот краткое руководство

      В первые месяцы пандемии для прохождения теста на коронавирус обычно требовалось посетить медицинский центр, лабораторию или специальный пункт тестирования, процесс, который иногда включал длинные очереди и ожидание недели или более, чтобы получить тест. полученные результаты.

      Теперь американцы могут сдавать экспресс-тесты на антигены, не выходя из дома. Многие из этих тестов доступны без рецепта и дают результаты всего за 15 минут.

      Спрос на тесты резко вырос в последние месяцы, так как очень заразный вариант Дельта распространился, а школы и офисы вновь открылись; теперь появился еще более заразный вариант Омикрон. «Все производители наращивают производство, но сейчас их трудно найти», — сказал Джиджи Гронвалл, эксперт по тестированию в Университете Джона Хопкинса.

      Хотя экспресс-тесты на антигены имеют свои ограничения, они являются важным инструментом общественного здравоохранения, говорят эксперты, особенно если вы знаете, как их использовать.

      «Наличие этой информации и возможность принимать более взвешенные решения очень важны», — сказала Мара Аспиналл, эксперт по биомедицинской диагностике в Университете штата Аризона, которая также входит в совет директоров OraSure, производящей экспресс-тесты на Covid. «И возможность делать это в режиме «пока вы ждете» — это то, чего мы не могли сделать год назад».

      Какие виды тестов доступны?

      Несколько экспресс-тестов на антигены доступны без рецепта, в том числе Abbott BinaxNOW, домашний тест Ellume Covid-19 и домашний тест Quidel QuickVue на Covid-19.Цены начинаются примерно с 7 долларов за тест, хотя президент Байден объявил о планах снизить цены примерно на треть.

      Все три обнаруживают небольшие вирусные белки, называемые антигенами. Тесты требуют втирания неглубокого мазка из носа в ноздри, а затем воздействия на мазок нескольких капель химических веществ. Они дают результаты примерно через 15 минут.

      Сами по себе тесты довольно просты, но каждый из них включает немного отличающуюся процедуру, которой следует следовать буквально.«Если вы проводите тесты дома, вы должны прочитать инструкции и неукоснительно им следовать», — сказал доктор Патрик Годби, , бывший президент Колледжа американских патологоанатомов.

      Мисс Аспиналл согласна. «Сейчас не время для творчества, — сказала она.

      Насколько точны экспресс-тесты на антигены?

      Тесты полимеразной цепной реакции, которые обычно считаются золотым стандартом для обнаружения вируса, обычно проводятся в лаборатории и включают создание множества копий генетического материала вируса.Этот процесс помогает P.C.R. тесты для обнаружения даже мельчайших следов вируса .

      Экспресс-тесты на антигены, которые не амплифицируют вирус, менее чувствительны, чем ПЦР. тесты. Если вы возьмете его на самой ранней стадии инфекции, до того, как вирус широко размножится, тест может дать ложноотрицательный результат.

      Некоторые домашние экспресс-тесты на антигены имеют общую чувствительность примерно 85 процентов, что означает, что они выявляют примерно 85 процентов людей, инфицированных вирусом, и пропускают 15 процентов.В некоторых исследованиях их реальная производительность была еще ниже.

      Но исследования показали, что тесты более чувствительны у людей с симптомами, чем без, и наиболее чувствительны в течение первой недели симптомов.

      А тесты на антигены отлично подходят для выявления людей с высокой вирусной нагрузкой, которые, таким образом, с наибольшей вероятностью активно передают вирус другим, говорят эксперты.

      «Чем больше вируса у вас в носу, тем больше вируса вы выдыхаете в воздух, и тем больше вируса могут вдохнуть другие люди», — говорит доктор.— сказал Гронвалл. «Тесты очень точны и очень хорошо коррелируют с ПЦР, когда люди наиболее заразны».

      Повторное использование тестов — например, для регулярного скрининга учащихся на наличие вируса — может компенсировать их более низкую чувствительность. В одном из недавних исследований исследователи обнаружили, что когда они тестировали инфицированных студентов и сотрудников колледжа каждые три дня, экспресс-тесты на антигены успешно выявляли 98 процентов инфекций, наравне с ПЦР. тесты.

      Когда и как их использовать?

      Экспресс-тесты на антиген в домашних условиях — хороший вариант для людей, подвергшихся воздействию вируса, которые хотят знать, является ли боль в горле Covid-19 или просто простудой, или кто хочет получить дополнительную уверенность перед посещением По словам экспертов, уязвимый родственник или после поездки в горячую точку вируса.

      Люди с симптомами могут немедленно пройти экспресс-тест на антиген, заявили эксперты, но тем, у кого был известный контакт с вирусом, следует подождать от трех до пяти дней, прежде чем делать это. Слишком раннее тестирование, до того, как вирус успел размножиться, увеличивает вероятность ложноотрицательного результата.

      «И это очень важная часть», — сказала мисс Аспиналл. «Многие люди садятся в самолет, выходят из самолета и говорят: «У меня отрицательное мнение — я могу пойти навестить бабушку». домашние тесты, однако, когда требуется доказательство отрицательного результата теста.

      У меня отрицательный результат. Что теперь?

      Экспресс-тесты на антигены лучше всего работают при серийном использовании. По словам экспертов, если у вас отрицательный результат после возможного или известного контакта с вирусом или после появления симптомов Covid-19, вам следует пройти второй тест через день или два.

      «Тесты — это момент времени», — сказал доктор Гронвалл. «Вы не знаете ни дня, ни часа», когда вирус «пробил вашу иммунную защиту и поселился».

      Но пока тесты не станут дешевле и доступнее, может быть трудно убедить людей использовать их чаще, отметила она.«Нам определенно нужно больше тестов на рынке, и нам нужно, чтобы они были дешевле», — сказал д-р Гронвалл.

      Я дал положительный результат. Что теперь?

      Экспресс-тесты на антигены обладают высокой специфичностью, что означает, что они дают относительно мало ложноположительных результатов. Однако положительный результат с большей вероятностью будет ложноположительным, когда распространенность вируса низкая; в этих случаях люди могут захотеть пройти второй тест. (Центры по контролю и профилактике заболеваний рекомендуют лабораторные молекулярные тесты, такие как P.CR test, для подтверждающего тестирования.)

      Но эксперты рекомендовали не ждать результатов повторного теста, чтобы начать принимать меры предосторожности. Если у вас положительный результат, вам следует изолировать себя, следить за своими симптомами и при необходимости обратиться за медицинской помощью.

      Потребители также должны сообщать о положительных результатах в местные органы здравоохранения.

      «Если мы не будем точно сообщать о тестах, у нас все равно не будет хорошего представления о фактической нагрузке — сколько людей бегает вокруг, которые могут быть заразными, которые могут передавать это другим людям», — доктор.— сказал Годби.

      Ошибки и мифы при тестировании на COVID-19

      Миф 2. Всплески числа случаев COVID-19 вызваны слишком большим количеством тестов.

      Факт: Тестирование — важный способ для экспертов в области здравоохранения отслеживать, насколько широко распространен вирус в сообществе, говорит Гиги Квик Гронвалл, доктор философии, старший научный сотрудник Центра безопасности здоровья Джона Хопкинса, который руководит Центром Джонса Хопкинса. Инструментарий для тестирования на COVID-19.

      «Мы знаем больше о случаях, связанных с тестированием, но тестирование не приводит к увеличению числа случаев», — сказал доктор.— говорит Гронвалл.

      Некоторые люди связывают всплески случаев COVID-19 с чрезмерным количеством тестов, но эксперты говорят, что это неверно. На самом деле, говорит доктор Свит, «если процент положительных результатов высок, это на самом деле означает, что вы недостаточно тестируете человек». Она добавляет: «Все всплески, которые я видела в последнее время, идут рука об руку с увеличением процента положительных результатов, что указывает на то, что всплески являются истинным увеличением вируса в сообществе».

      Миф 3: ПЦР-тест всегда лучше, чем тест на антиген.

      Факт: Для выявления COVID-19 используются два разных типа тестов. Одним из них является тест полимеразной цепной реакции (ПЦР), который ищет следы генетического материала вируса и является достаточно чувствительным, чтобы обнаруживать инфекцию на самой ранней стадии. Эти тесты доступны в специализированных центрах тестирования на COVID-19, больницах, кабинетах врачей и т. д., при этом образцы отправляются в лабораторию, которая обычно дает результаты в течение одного или нескольких дней.

      Другим основным видом диагностического теста является тест на антиген, также известный как экспресс-тест, который выявляет присутствие специфической молекулы, которая указывает на текущую вирусную инфекцию, но не документирует ее напрямую, что делает его немного менее точным.Результаты доступны в течение нескольких минут, поэтому этот тип теста используется дома.

      Специально для тех, кто испытывает симптомы COVID-19 или подвергается повышенному риску заражения: «Лучший тест — это легкодоступный тест», — говорит Мелани Свифт, доктор медицины, магистр здравоохранения, сопредседатель вакцины против COVID-19 клиники Майо. Рабочая группа по распределению и распределению в Рочестере, Миннесота.

      Поскольку тест на антиген может пропустить низкий уровень инфекции, если вы получите отрицательный результат (это означает, что тест говорит, что у вас нет COVID-19), для максимальной точности вам необходимо пройти либо второй тест на антиген — как правило, из От 24 до 48 часов — или ПЦР-тест для подтверждения.— говорит Свифт.

      Во многих случаях тест на антиген является лучшим вариантом, говорит она. Поскольку его можно использовать дома, «тесты на антигены — хороший выбор для людей без симптомов, которые хотят провериться до или после путешествия или которым необходимо пройти тестирование в рамках программы наблюдения», — говорит Свифт.

      Миф 4: Тестирование крайне неудобно, потому что мазок нужно вводить очень глубоко в нос .

      Факт: В начале пандемии тесты на COVID-19 требовали введения тампона до места, где нос встречается с верхней частью горла, в области, известной как носоглотка.Ученые были уверены, что если бы вирусная активность присутствовала, она была бы обнаружена там, в области, где размножается коронавирус.

      Но многие люди не переносят ощущение мазка глубоко в носовом проходе, поэтому критерии тестирования были изменены на среднюю часть носового хода — менее дюйма — область, известную как область средней носовой раковины. «Это намного проще и удобнее», — говорит Свит.

      Образцы, взятые из носоглотки, до сих пор остаются самыми точными. Обзорное исследование, опубликованное в PLoS One в июле 2021 года, показало, что точность тестов с использованием мазка из носоглотки составляет 98 процентов, в то время как точность тестов с использованием мазков из средней носовой раковины или даже более мелких составляет от 82 до 88 процентов.

      Тем не менее, эта более низкая чувствительность компенсируется возможностью скрининга большего количества пациентов, поэтому стоит взять более мелкую выборку, заключают авторы исследования.

      Миф 5: Если в коробке два экспресс-теста, вы должны использовать один, а другой оставить для другого случая.

      Факт: Несколько брендов экспресс-тестов на COVID-19, доступных в настоящее время, таких как Abbott BinaxNOW и Quidel QuickVue, упакованы в виде набора из двух штук.

      Если вы получите отрицательный результат одного из этих тестов, вам будет предложено пройти второй тест в течение трех дней с перерывом между тестами — как правило, не менее 24 часов и не более 48 часов (проверьте инструкции в вашем комплект для проверки).

      Это связано с тем, что тесты на антигены могут давать ложноотрицательный результат, если вы проводите тест слишком рано в ходе болезни, когда уровень вируса слишком низок, чтобы его можно было обнаружить. К тому времени, когда вы сделаете второй тест, он должен быть положительным, если у вас действительно есть COVID-19.

      (Если любой из двух тестов положительный, вам следует обратиться к врачу, а также остаться дома и изолироваться от других людей.)

      Миф 6. Даже если вы не домашний тест точно, ваши результаты, вероятно, все еще будут точными.

      Факт: При сдаче домашнего теста на COVID-19 крайне важно точно следовать инструкциям. Если вы отклонитесь даже немного, ваши результаты могут быть неточными.

      Например, для теста Abbott BinaxNOW инструкции требуют мазка с внутренней стороны носа в течение 15 секунд. Если вы берете мазок в течение более короткого промежутка времени, вы можете не собрать достаточно образца для теста, чтобы обнаружить признаки вируса. Точно так же тест требует, чтобы на тестовую карту было нанесено ровно 6 капель раствора.Большее или меньшее количество капель может привести к неправильной работе теста.

      Поскольку очень важно, чтобы вы точно следовали инструкциям по тестированию, вы всегда должны потратить несколько минут, чтобы прочитать все шаги, прежде чем начать, даже если вы уже проводили тест раньше.

      Миф 7: Вам не нужна вакцина против COVID-19, если вы регулярно проходите тестирование.

      Факт: Любая из разрешенных вакцин против COVID-19 резко снижает вероятность того, что вы заразитесь COVID-19, и особенно вероятность того, что вы будете госпитализированы или умрете от этой болезни.

      Тестирование, напротив, не может предотвратить заболевание. «Регулярное тестирование не предотвратит COVID или не остановит распространение», — говорит Гронвалл. Это похоже на то, как регулярная маммография не может уберечь вас от рака молочной железы.

      Регулярные анализы могут предупредить вас о том, что вы больны на ранних стадиях болезни. Затем вы можете изолироваться, чтобы не заразить других, а также уведомить своих близких контактов о том, что им также следует пройти тестирование и поместить в карантин. Таким образом, вы не передадите COVID-19 (многим) другим.

      Тем не менее, нет лучшего способа защитить себя и других, чем вакцинация.

      Миф 8: Если у вас отрицательный результат теста, вам не нужно носить маску или принимать другие меры предосторожности.

      Факт: «Отрицательный тест не является разрешением на отказ от маскировки, социального дистанцирования или других обычных мер предосторожности, когда COVID циркулирует в вашем сообществе», — говорит Свифт.

      Во-первых, Свит говорит: «Тесты не являются надежными. Есть несколько ложноотрицательных результатов», когда результаты теста указывают на то, что вы здоровы, даже если вы инфицированы.Кроме того, отрицательный результат теста означает, что вирус не был обнаружен во время теста . Возможно, вы инфицированы слишком рано, чтобы тест мог обнаружить болезнь, или вы могли быть здоровы, когда проходили тест, но затем заразились COVID-19.

      Это означает, что лучший способ защитить себя и других — носить маску и соблюдать социальную дистанцию ​​во время циркуляции вируса, регулярно мыть руки и, конечно же, получать вакцину и все бустеры — в дополнение к тестированию, когда это необходимо.

      «Это не или-или.Нам действительно нужен многоуровневый подход», — говорит Свит.

      ПЦР-тестирование на коронавирус — как это работает?, Исследование, кафедра биохимии, Университет Отаго, Новая Зеландия

      Существует множество различных способов узнать, заражен ли кто-то коронавирусом SARS-CoV-2, который вызывает болезнь под названием Covid-19. Самый точный называется тестом ПЦР.

      ПЦР-тест ищет генетический материал вируса в образце мазка, взятого из носа или горла человека.Он включает в себя создание множества копий фрагмента генетического материала вируса, чтобы мы могли увидеть, есть он там или нет.

      ПЦР также является одним из наиболее важных методов, которые мы используем в наших исследованиях на кафедре биохимии Отаго.

      Но как это работает?

      1) Возьмите мазок

      Что происходит с этими длинными палочками в носу у людей?


      Медицинский работник собирается взять у кого-то мазок на тест на коронавирус.

      Чтобы выяснить, есть ли у человека коронавирус, медицинский работник использует тампон с длинным стержнем, чтобы осторожно соскоблить заднюю часть носоглотки этого человека.Носоглотка — это верхняя часть горла, сразу за носом. Не очень удобно!

      Вот где находится ваша носоглотка:


      Изображение из статьи «Анатомия человека, включая строение, развитие и практические соображения» (1911 г.) на сайте www.flickr.com

      клеток человека и слизи на нем, а также любых бактерий или вирусов, которые сидели там сзади.

      Тампон быстро помещают в пробирку, содержащую смесь белка и антибиотиков, которая обеспечивает безопасность любого собранного вируса, затем пробирку запечатывают и отправляют в лабораторию для тестирования.

      Вы можете увидеть, как берут мазок, в этом видео, сделанном медицинской образовательной компанией AMBOSS.

       

      Проблемы с взятием мазка

      Обычно, если кто-то инфицирован вирусом и у него проявляются симптомы, мазок должен улавливать частицы вируса из носоглотки.

      Однако иногда вирус может размножаться в местах, удаленных от мазка, или вокруг еще недостаточно вируса, чтобы мазок мог его подобрать.

      Таким образом, отрицательный результат теста может означать, что у вас нет коронавируса, или что у вас есть коронавирус, но он просто еще не обнаружен, или мазок взят не из той части тела.

       

      Затем отправьте образец мазка в лабораторию

      Надеюсь, курьер приедет быстро!

       

      2) Извлеките генетический материал РНК и очистите его

      С чем мы имеем дело:

      Коронавирус состоит из двух основных частей: маслянистой оболочки снаружи, усеянной торчащими белками поверхности и генетический материал, называемый РНК, внутри, вокруг которого плотно обернуто большее количество белков.

      Вот рисунок частицы коронавируса, разрезанной пополам, чтобы вы могли видеть внутреннюю часть. Белки, торчащие из внешней мембраны, окрашены в розовый цвет. Внутри вы можете увидеть тонкую волнистую РНК, обернутую фиолетовыми белками.


      Иллюстрация Дэвида С. Гудселла, RCSB Protein Data Bank.

      Чтобы сделать тест на коронавирус, мы должны взломать вирусные частицы, чтобы получить генетический материал. Нам также нужно избавиться от всего остального в образце, что может помешать работе теста.

      Образец мазка будет содержать множество веществ, включая слизь и человеческие клетки, а также вирусы. Клетки человека также состоят из белков, мембран, ДНК и РНК.

      Это означает, что нам нужно будет избавиться от частей вируса, которые нам не нужны для теста (белки и маслянистая оболочка), и всего остального в образце – белков, маслянистой оболочки и ДНК из слизи и человека. клетки.

       

      Итак… разрушаем молекулы, которые нам не нужны…

      Мы разрушаем вирусные частицы, используя некоторые химические вещества – моющее средство и нечто, называемое хаотропной солью.


      При разбиении вируса на части высвобождается его РНК (волнистая линия красного цвета).

      Моющее средство помогает разрушать мембраны клеток и вирусов, которые состоят из маслянистых молекул.

      Хаотропная соль выполняет несколько функций. Он денатурирует или распутывает множество различных белков в образце, останавливая их работу, и помогает отделить РНК от любых белков, обернутых вокруг нее.

      Мы измельчаем белки в образце на кусочки, используя фермент, называемый протеазой, и мы измельчаем ДНК в образце на кусочки, используя фермент, называемый ДНКазой.

       

      … Тогда избавьтесь от всего, кроме РНК.

      Теперь у нас есть пробирка с множеством различных типов расщепленных молекул, смешанных с РНК. Нам нужно избавиться от всего, кроме РНК.

      Чтобы убедиться, что мы сохраним РНК и не смоем ее случайно, мы добавляем маленькие магнитные шарики из кремнезема (стекла). РНК прилипает к гранулам кремнезема, чему способствуют хаотропные соли. Затем прикладываем магнит к внешней стороне трубки. Бусины (и, следовательно, РНК) прилипают к внутренней стенке пробирки, удерживаемые магнитом снаружи.

      С помощью магнита, удерживающего шарики и РНК на месте, вы можете легко смыть все оставшиеся фрагменты нежелательных молекул без потери РНК. Добавление жидкости с еще хаотропной солью поможет сделать это, затем мы можем смыть соль спиртом.

      После того, как РНК станет чистой, мы можем отклеить ее от шариков магнитного кремнезема, просто промыв шарики водой. Когда РНК окажется в воде, а не на шариках, мы снова сможем избавиться от шариков с помощью магнита.

      На этом рисунке показаны шаги, которые мы используем для очистки РНК:

        

      3) Убедитесь, что тест выявляет только новый коронавирус семь коронавирусов, которые, как известно, вызывают заболевания у людей.


      8

      Этот вирус: 2
      SARS-COV SARS
      SARS-COV-2 COVID-19
      МЭРС-COV МЭРС
      HCoV-OC43 Общие холодные
      HCoV-HKU1 Простуда
      HCoV-229Е Простуда
      HCoV-NL63 Общие простуда

      РНК, оставшаяся в вашем образце, будет представлять собой смесь РНК человека и РНК любых бактерий или вирусов из носоглотки человека, у которого был взят мазок.

      Чтобы убедиться, что мы обнаруживаем только РНК коронавируса, а не ДНК или РНК любого другого организма, нам нужно найти небольшую часть последовательности РНК коронавируса, которая уникальна для коронавируса и не используется ни одним другим живым организмом. предмет.

      РНК нового коронавируса была секвенирована учеными в начале вспышки. В геноме коронавируса около 30 000 оснований (букв), содержащих инструкции по созданию 29 различных белков.

      Вот схема этого генома:

      Нам нужно сделать два коротких фрагмента ДНК («праймеры»), которые будут прилипать только к какой-либо части этой последовательности генома.

      Ученые выбрали два коротких фрагмента последовательности гена Е длиной 22 и 26 оснований для ПЦР-теста. Белок E (оболочка), кодируемый этим геном, помогает формировать маслянистую мембрану вируса.

      Ученые создали ДНК-праймеры, которые прилипают только к этим фрагментам гена Е и больше нигде.

      (Кстати, ДНК и РНК склеиваются, если они имеют правильную последовательность.)

      Вот последовательность РНК гена E (РНК состоит из G, C, A и U оснований) :

      AUGUACUCAUUCGUUUCGGAAGAGACAGGUACGUUAAUAGUUAAUAGCGUACUUCUUUUUCUUGCUUUCGUGGUAUUCUU
      GCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGUGUGCGUACUGCUGCAAUAUUGUUAACGUGAGUCUUGUAAAAC
      CUUCUUUUUACGUUUACUCUCGUGUUAAAAAUCUGAAUUCUUCUAGAGUUCCUGAUCUUCUGGUCUAAACGAACUAAAUA
      UUAUAUUAGUUUUUCUGUUUGGAACUUUAAUUUUAGCC

      а вот последовательности двух праймеров ДНК, используемых в тесте (ДНК состоит из G, C, A и Т оснований):

      вперед грунтовка: ACAGGTACGTTAATATATTAATAGCGT
      Обратный грунтовтер: ATATTGCAGCAGTACGCACACA

      70002

      Грунтовки будут только придерживаться гена E, на части, подчеркнутые здесь:

      AUGUACUCUUCGUUUUCGGAGAGAGAGUAUAUAUAUAUAGC GU
      ACUUCUUUUUCUUGCUUUCGUGGUAUUCUU GCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAU UGUGUGCGUACUGCUGCAAUAU UGUUAACGUGAGUCUUGUAAAAC
      CUUCUUUUUACGUUUACUCUCGUGUUAAAAAUCUGAAUUCUUCUAGAGUUCCUGAUCUUCUGGUCUAAACGAACUAAAUA
      UUAUAUUAGUUUUUCUGUUUGGAACUUUAAUUUUAGCC

      Это как тест будет только обнаружить РНК коронавируса, а не РНК ничего другого.

       

      4) Если есть вирус, сделайте ДНК!

      Время для ОТ-ПЦР

      Чтобы обнаружить любую присутствующую РНК коронавируса, нам нужно сделать много-много ее копий, но мы не можем легко сделать много копий РНК напрямую.

      Таким образом, мы сначала должны сделать ДНК-копию РНК. Это называется обратной транскрипцией (RT), которую мы делаем с помощью фермента, называемого обратной транскриптазой.

      Когда у нас есть копия ДНК, мы можем сделать множество копий, используя полимеразную цепную реакцию (ПЦР) и фермент, называемый ДНК-полимераза.

      Мы используем праймеры гена E на обоих этапах, чтобы копировать только РНК вируса и ничего больше.

      В этом видеоролике показано, как работает ОТ-ПЦР.

       

      Как узнать, успешно ли скопирована вирусная РНК?

      Испытательные лаборатории проводят 45 «циклов» ПЦР на тестовом образце Covid-19, что занимает чуть более получаса. По истечении этого времени одна молекула РНК SARS-CoV-2 превратится в 17 миллионов миллионов идентичных молекул ДНК.Они настолько малы, что вы ВСЕ ЕЩЕ не можете видеть их глазами.

      Чтобы увидеть количество ДНК и узнать, положительный ли тест, в реакционную смесь для ПЦР включена специальная метка, которая светится при разрезании.

      Метка прикрепляется к тому же участку ДНК, что и один из праймеров.

      Когда ДНК копируется, метка сбивается с ДНК и измельчается. Затем отклеившаяся, нарезанная метка начинает флуоресцировать (светиться).

      Эти метки можно «увидеть» и измерить с помощью устройства, обнаруживающего свет.Чем больше флуоресценции обнаружено в результате реакции ПЦР, тем больше копий ДНК было сделано.

      Итак, когда много свечения, вы знаете, что РНК коронавируса была в образце мазка и было сделано много копий ДНК, и, следовательно, тест положительный.

      Если свечения нет, в образце мазка не было коронавируса, копии ДНК сделать не удалось, тест отрицательный.

       

      Делайте много тестов одновременно (Задействуйте роботов!!!)

      Действительно важная часть тестирования на коронавирус заключается в том, что мы можем проводить множество тестов как можно быстрее.

      Наши испытательные лаборатории делают это, заставляя роботов выполнять подготовку РНК и ПЦР с обратной транскрипцией.

      Один человек может вручную обрабатывать около 100 образцов каждый день, но правильно настроенный робот может провести до 1000 тестов за 24 часа и с меньшей вероятностью допустит ошибки.

      Это одна из роботизированных машин для тестирования, которые мы используем в Новой Зеландии:

       

      Вопросы о ПЦР-тестах на новый коронавирус

      Что произойдет, если у нас закончатся наборы для тестирования из-за границы?

      Наши друзья из Отделения микробиологии и иммунологии Отаго помогли провести этот тест в Новой Зеландии.Они разработали его для работы с ферментами и другими реагентами, которые мы можем импортировать из-за границы.

      Но что произойдет, если некоторых из этих реагентов из-за границы не будет, и мы не сможем их ввозить какое-то время?

      Медицинские работники, ученые и средства массовой информации подчеркивают, что это проблема, над которой нам нужно подумать. (Прочитайте статью на RNZ: Covid-19: ограниченные наборы для тестирования заставляют ученых искать непатентованную альтернативу.)

      Мы можем провести важные части теста здесь, в Новой Зеландии, если нам нужно.

      Здесь могут помочь навыки и оборудование исследовательских институтов, таких как Otago Biochemistry.


      Сэм Джеймисон очищает фермент обратной транскриптазы в лаборатории Mace.

      В Otago Biochemistry мы уже практиковались в изготовлении ферментов на всякий случай. Исследовательская группа адъюнкт-профессора Питера Мейса уже создала фермент обратной транскриптазы.

      Они поместили ген, кодирующий фермент, в некоторые бактерии, заставили бактерии производить фермент, а затем извлекли фермент из бактерий.

      Ученые часто создают белки таким образом, чтобы мы могли изучить их и выяснить, как они работают.


      Фотография геля, на которой показан фермент на разных стадиях очистки. Большие пятна справа — образцы чистого фермента обратной транскриптазы.

      Может ли тест ПЦР различать варианты Covid-19?

      Хотя можно было бы разработать тест ПЦР, который бы различал несколько известных вариантов Covid, те, которые мы используем, этого не делают.

      Чтобы выяснить, какой вариант дал положительный результат, определяется полная последовательность генома. ПЦР делает множество копий одного небольшого фрагмента ДНК, но секвенирование генома «считывает» всю последовательность из 30 000 оснований (основания часто называют «буквами», поскольку они записываются как A, U, C и G) последовательности вирусной РНК, используя другой процесс. Так обнаруживаются новые варианты и прослеживаются связи между случаями. Когда вирус размножается в наших клетках, он иногда совершает ошибки. Вот как она развивается — и действительно, как развиваются люди, растения и все другие живые существа.

      Большинство ошибок практически не влияют на то, как действует вирус, но мы можем их увидеть, когда секвенируем образец. Если два образца от разных людей имеют абсолютно одинаковую последовательность, мы знаем, что люди очень тесно связаны — вполне вероятно, что один из них заразился вирусом от другого. Если между двумя образцами есть только одно базовое различие, мы знаем, что они также очень тесно связаны. Если есть пять различий, то между двумя людьми будет много стадий заражения.

      Некоторые ошибки имеют значение, и если это различие является преимуществом для вируса, то этот «вариант» становится доминирующим. Обычно это будет не одна базовая ошибка, а чаще совокупность нескольких, накопившихся за какой-то период времени. Это произошло с вариантом Delta. Мы наблюдаем, как происходит эволюция.

      Дополнительную информацию о секвенировании генома Covid в Новой Зеландии можно найти здесь: https://www.esr.cri.nz/our-expertise/covid-19-response/new-news-page/

      Кто контролирует ПЦР-тест в Новой Зеландии и все данные оттуда?

      Тестирование проводится во всевозможных испытательных лабораториях, в больницах и в Институте экологических исследований и исследований (ESR) Новой Зеландии.Каждая лаборатория, проводящая испытания, должна быть аккредитована Международной аккредитацией Новой Зеландии (IANZ). Все результаты тестов попадают в базу данных NHI, которая содержит все медицинские данные и доступна для медицинских работников. Ваш врач общей практики может принадлежать онлайн-порталу, который позволяет вам получить доступ к результатам ваших собственных тестов.

      Какова точная «скорость усиления» Covid-19? Какой номер CT они используют в Новой Зеландии?

      На самом деле по всему миру доступны сотни различных коммерческих наборов для ПЦР-тестов, и не все из них работают одинаково.Этот ответ применим к большинству из них и ко всем тестам, проведенным в Новой Зеландии.

      В Интернете циркулирует много недостоверной и дезинформации относительно значений КТ. Роботы, выполняющие ПЦР-тесты, работают в течение 40 циклов, но в этот момент результаты НЕ даются как положительные или отрицательные.

      Количество выполненных циклов не имеет значения. Сотни реакций выполняются одновременно, а реакция ПЦР отслеживается в режиме реального времени.

      Результаты представлены в виде числа CT (порог цикла), которое представляет собой количество циклов, которое потребовалось для появления положительного результата.

      Низкое число CT = много вируса
      Высокое число CT = очень мало вируса или его отсутствие

      Если образец дает положительный результат менее чем за 25 циклов, он считается «положительным». Если положительный результат появлялся после 25 циклов и до 35 циклов, это расценивалось как подозрительное, и человека тестировали повторно.

      Чем выше число CT, тем меньше исходной вирусной РНК присутствовало, а высокое число CT может означать одно из двух: либо случай исторический, и тест выявил вирусные фрагменты, которые больше не являются инфекционными, ИЛИ это очень новая инфекция, и вирусная нагрузка все еще низкая.Второй тест из нового образца покажет, что из этого имеет место — при новом заражении второй тест даст гораздо меньшее число CT, которое показывает, что в образце больше вируса.

      Вы, должно быть, слышали, как доктор Блумфилд говорил об «исторических случаях» и «слабых положительных результатах» — именно об этом он говорит.

      В Новой Зеландии у нас достаточно мало случаев Covid, чтобы мы могли провести все эти последующие тесты, а также секвенировать геномы всех наших положительных случаев. В других странах это не всегда так.

      Ниже представлено аннотированное изображение результатов ПЦР в реальном времени — в данном случае они проверяют не на Covid, а на количество говядины в переработанном мясе — однако принцип тот же.

      Следует ли игнорировать результаты теста ТТ со значением ТТ более 35?

      Если вы посмотрите на оценки ПЦР-тестов на covid (ни один из них не используется в Новой Зеландии) на видим, что числа CT для 1-10 молекул РНК варьируются от 30 до 40.

      Таким образом, говорить, что на что-либо старше 35 лет не следует смотреть, не обязательно правильно.

      Вы должны помнить, что люди, чьи тесты имеют высокие значения CT, проходят повторное тестирование и классифицируются как положительные только в том случае, если значение CT ниже во втором тесте.

      Также возможен ложноотрицательный результат теста, и если у человека проявляются все признаки наличия ковида и он был где-то, где мог заразиться, он будет повторно протестирован, даже если его ПЦР-тест показал полностью отрицательный результат.Ложноотрицательные результаты могут возникать, когда исходный мазок не содержит вируса, это может произойти, если инфекция базируется глубоко в легких, а не в носу, или даже если пациент вздрогнул во время взятия мазка! Ложноотрицательные результаты встречаются гораздо чаще, чем ложноположительные.

      Здесь есть статья, которая отвечает на некоторые вопросы о числах КТ и «слабых положительных результатах»: https://www.stuff.co.nz/national/health/coronavirus/122865913/when-is-a-covid19-test- результат-слабо-положительный-почему-больше-их-выявляется-и-как-делаются-с-делами-с

      Доктор Блумфилд приводит цифры: до 25 для положительного результата, около 30 за запрос и более 35 за исторический случай.Но опять же, если человек не дает положительного результата теста, но подвергся воздействию Covid-19 и у него проявляются симптомы, он будет повторно протестирован независимо от того, насколько высоким было значение КТ исходного теста.

      Где отображаются данные? Как работают объединенные тесты?

      Данные по отдельным тестам нигде не отображаются публично. Большинство тестов даже не являются «индивидуальными».

      Чтобы лаборатории могли обрабатывать огромное количество тестов на Covid-19, они часто объединяют образцов.Они берут образцы у людей по отдельности, затем берут небольшую часть каждого образца и объединяют их с несколькими другими образцами в одну пробирку. Затем они проводят реакцию ПЦР на объединенном образце. Помните — они использовали для этого только небольшую часть первоначального образца, остальное им может понадобиться позже.

      Хотя у нас в Новой Зеландии очень мало Covid-19, почти все объединенные тесты дадут отрицательный результат, а поскольку тест достаточно чувствителен, чтобы обнаружить один положительный образец в объединенном образце, отрицательный объединенный образец означает все отдельные образцы отрицательные.

      Если объединенный образец дает положительный результат, образцы, из которых состоит пул, затем повторно тестируются по отдельности, чтобы найти положительный(е).

      Это действительно очень умно и экономит много времени и денег (эти тесты действительно дорогие, если они вам нужны для путешествий, они будут стоить вам более 200 долларов).

      Конечно, если у них есть основания полагать, что образец БУДЕТ положительным, т.е. Людям с симптомами, побывавшим в «достопримечательностях», быстрее и эффективнее сначала протестировать их индивидуально, вот что они делают.

      Дополнительную информацию о тестировании на Covid можно найти в Министерстве здравоохранения: https://www.health.govt.nz/our-work/diseases-and-conditions/covid-19-novel-coronavirus/covid-19-health -advice-public/assessment-and-testing-covid-19/how-covid-19-testing-works

      Может ли положительный тест сказать нам, заразен ли человек в настоящее время или насколько он может заболеть?

      Вирусы на самом деле не являются живыми существами, проще говоря, они представляют собой пучки самовоспроизводящегося генетического материала, завернутые в белок.Они не могут производить свои собственные белки, для этого им приходится захватывать «механизм» живой клетки.

      Когда организм успешно защищается от вируса, вирусные частицы разрушаются, высвобождая генетический материал и белки в организм. Затем этот мусор удаляется нормальными клеточными процессами, но часть его может задерживаться в укромных уголках носа и горла.

      Когда лаборатории проверяют присутствие вируса, они на самом деле обнаруживают присутствие генетического материала (РНК), и часть подготовки к этому состоит в том, чтобы разрушить и вымыть окружающие его белки и мембраны.

      Таким образом, вы можете видеть, что было бы невозможно сказать, находилась ли обнаруженная РНК изначально в интактной вирусной частице (заразной) или просто плавала сама по себе (не заразная) в тестируемой слизи!

      Поскольку большая часть вирусных остатков выводится организмом довольно быстро, мы можем сказать, что если присутствует много-много РНК — низкое число CT — почти наверняка эта РНК произошла от вирусов, которые в настоящее время являются частью вируса. инфекция.

      Что касается того, насколько человек может заболеть, это зависит от самого человека и от того, скольким вирусным частицам он подвергся впервые.Все люди разные, реакция организма на инфекцию у всех разная, и предсказать, какой она будет, просто невозможно. Точно так же, как некоторые люди очень сильно болеют свинкой, а другие даже не знают, что переболели ею.

      Правда ли, что CDC в США запретил тест ПЦР, потому что он не может отличить Covid-19 от гриппа?

      Центры по контролю и профилактике заболеваний сообщили, что они не будут подавать заявки на продление срока действия разрешения на экстренное использование ПЦР-теста на Covid-19, который они предоставляют, после декабря 2021 года.Это потому, что они заменяют его комбинированным тестом ПЦР, который может обнаружить как Covid-19, так и два штамма гриппа.

      ПЦР-тест, предоставляемый CDC, является лишь одним из сотен, и они рекомендуют лабораториям, которые в настоящее время используют их стандартный тест, заменить его комбинированным тестом — либо своим, либо тестом другого поставщика. Комбинированный тест дает больше данных о респираторных заболеваниях — Центры по контролю и профилактике заболеваний хотят знать, сколько вокруг гриппа, а также сколько Covid-19.

      В таблице ниже указано, что покажут различные тесты:

      7 Если у вас есть грипп A 9052
      Результат стандартного ПЦР-теста на Covid-19 Результат комбинированного ПЦР-теста на Covid-19/грипп
      8 Если у вас есть Covid-19 8 положительный положительный на COVID-19
      отрицательный отрицательный положительный для гриппа A
      Если у вас есть COVID-19 и грипп A положительный положительный Грипп A и COVID-19
      Если у вас есть грипп B отрицательный положительный на грипп B
      Если у вас есть COVID-19 и грипп B положительный положительный на грипп B и COVID-19
      Если у вас есть грипп A и Rightenza B отрицательный положительный на грипп A и грипп B
      Если у вас грипп A и грипп B и Covid-19 (крайне маловероятно!) Положительный результат Положительный результат на грипп A и грипп B и covid-19
      Если у вас простуда или другое заболевание, но не Covid-19 или грипп Отрицательный Отрицательный

      Вот объявление CDC.


      Вот информация о новом комбинированном (мультиплексном) тесте, который они предоставляют.


      Во всем мире проводится огромное количество исследований нового коронавируса. Мы собрали коллекцию ссылок на полезные веб-сайты, которые объясняют, как выглядит вирус, как он работает, как его тестировать, какие методы лечения и вакцины разрабатываются, и многое другое на нашей странице «Полезная информация о новом коронавирусе».

      Вы можете прочитать и посмотреть другие истории об исследованиях в Otago Biochemistry на нашей странице школьных ресурсов.

      Свяжитесь с нами с любыми предложениями по улучшению или дополнению этой страницы по адресу [email protected]

      Оценка экспресс-теста для выявления антигена SARS-CoV-2 в качестве самотестирования: диагностические характеристики и удобство использования

      J Med Virol. 2021, 26 августа: 10.1002/jmv.27249.

      , 1 , 2 , 3 , 3 , 3 , 3 , 4 , 3 и 3

      Нино Гай Кассуто

      1 Лаборатории Друо, Париж Франция,

      Энн Гравье

      2 Центр бесплатной информации, депистаж и диагностика (CeGIDD) Орлеан, Centre Hospitalier Régional d’Orléans, Орлеан Франция,

      Матильда Колин

      3 Centre Hospitalier Régional d’Orléans, Служба инфекционных и тропических заболеваний, Орлеан Франция,

      Орели Тейлей

      3 Centre Hospitalier Régional d’Orléans, Служба инфекционных и тропических заболеваний, Орлеан Франция,

      Даниэла Пирес-Ротейра

      3 Centre Hospitalier Régional d’Orléans, Служба инфекционных и тропических заболеваний, Орлеан Франция,

      Сандра Паллай

      3 Centre Hospitalier Régional d’Orléans, Служба инфекционных и тропических заболеваний, Орлеан Франция,

      Рафаэль Серро

      4 Служба медицинской профилактики, Орлеанский Метрополь, Орлеан Франция,

      Лоран Окелу

      3 Centre Hospitalier Régional d’Orléans, Служба инфекционных и тропических заболеваний, Орлеан Франция,

      Тьерри Празук

      3 Centre Hospitalier Régional d’Orléans, Служба инфекционных и тропических заболеваний, Орлеан Франция,

      1 Лаборатории Друо, Париж Франция,

      2 Центр бесплатной информации, депистаж и диагностика (CeGIDD) Орлеан, Centre Hospitalier Régional d’Orléans, Орлеан Франция,

      3 Centre Hospitalier Régional d’Orléans, Служба инфекционных и тропических заболеваний, Орлеан Франция,

      4 Служба медицинской профилактики, Орлеанский Метрополь, Орлеан Франция,

      Автор, ответственный за переписку. * Для корреспонденции Тьерри Празук, Центральный госпиталь Орлеана, Служба инфекционных и тропических заболеваний, Орлеан, Франция.
      Электронная почта: [email protected]

      Поступила в редакцию 25 мая 2021 г.; Пересмотрено 12 июля 2021 г .; Принято 29 июля 2021 г.

      Эта статья находится в свободном доступе через PubMed Central в рамках мер реагирования на чрезвычайную ситуацию в области общественного здравоохранения COVID-19. Его можно использовать для неограниченного повторного использования и анализа в исследованиях в любой форме и любыми средствами с указанием первоисточника на время чрезвычайной ситуации в области общественного здравоохранения.

      Эта статья была процитирована другими статьями в PMC.

      Abstract

      Для борьбы с распространением эпидемии коронавирусной болезни 2019 (COVID-19) необходимо иметь простые в использовании надежные диагностические тесты. Поскольку метод забора проб из носоглотки часто неудобен, он может оказаться жизнеспособной альтернативой эталонному методу отбора проб. Мы провели многоцентровое проспективное проверочное исследование теста COVID-VIRO® с использованием метода забора мазка из носа в условиях оказания медицинской помощи.Кроме того, мы провели многоцентровое проспективное исследование удобства использования, чтобы подтвердить использование экспресс-назального диагностического теста на антигены неспециалистами. В марте 2021 года в проверочное исследование было включено 239 бессимптомных и симптоматических пациентов. По сравнению с полимеразной цепной реакцией с обратной транскрипцией на образцах из носоглотки чувствительность и специфичность теста на антиген COVID-VIRO® в сочетании с методом забора образцов из носа оценивались как 96,88% и 100% соответственно. Всего в исследование юзабилити был включен 101 человек.Среди них 99% участников оценили материал инструкций как хороший, 98% испытуемых хорошо выполнили процедуру теста, а 98% участников смогли правильно интерпретировать результаты теста. Это исследование подтверждает актуальность COVID-VIRO® в качестве диагностического инструмента по образцам из носа, а также его применимость для населения в целом. Диагностические характеристики COVID-VIRO® и простота использования делают его пригодным для широкого применения.

      Ключевые слова: тестирование на антиген , COVID-19, диагностическое тестирование, забор проб из носа, SARS-CoV-2, самотестирование, удобство использования

      1.ВВЕДЕНИЕ

      Вирус тяжелого острого респираторного синдрома коронавирус 2 (SARS-CoV-2) вызывает инфекционное респираторное заболевание, известное как коронавирусная болезнь 2019 (COVID-19). С момента вспышки в Ухане, Китай, в конце 2019 г. болезнь распространилась на все население мира, и 11 марта 2020 г. Всемирная организация здравоохранения (ВОЗ) присвоила статус пандемии1. Инфекция SARS-CoV-2 в основном вызывает пневмонию и инфекция дыхательных путей.2 Симптомы инфекции COVID-19 появляются после среднего инкубационного периода около 5.2 дня.2 Наиболее распространенными ранними симптомами болезни COVID-19 являются лихорадка, кашель и усталость, но другие симптомы включают головную боль, боль в горле и даже острый респираторный дистресс-синдром, приводящий к дыхательной недостаточности.

      Чтобы контролировать распространение эпидемии, очень важно иметь высокочувствительные и специфичные тесты. Действительно, эти тесты являются ключевыми для выявления и лечения случаев COVID-19, а также для реализации мер контроля. На данный момент золотым стандартом для выявления инфекции SARS-CoV-2 является метод полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР), основанный на молекулярном обнаружении генетического материала вируса в образце из носоглотки.3 Это обнаружение очень чувствительно и надежно, но требует очень специфических и довольно дорогих материалов и оборудования. Кроме того, забор образцов из носоглотки требует обучения для безопасного и надежного выполнения, а результаты иногда можно получить только через несколько дней, в зависимости от лаборатории. Наконец, хотя забор образцов из носоглотки, как правило, безопасен, эта процедура не лишена риска, особенно при повторяющемся и интенсивном выполнении. 4 Действительно, в некоторых редких случаях были зарегистрированы цереброспинальная утечка и менингит.5, 6, 7 Взятие проб слюны недавно было одобрено и оказалось столь же надежным и простым, чем взятие проб из носоглотки, но по-прежнему не дает быстрого результата.8 Для быстрого, надежного и простого анализа недавно были разработаны иммуноанализы с латеральным потоком. для выявления наличия антигенов вируса в образцах носоглотки. Эти экспресс-тесты для диагностики антигенов (RADT), специфичные для SARS-CoV-2, представляют собой простую и быструю альтернативу методу ОТ-ПЦР и доступны в аптеках.Чтобы получить результат, требуется около 15 минут, но из-за метода выборки они не подходят для стратегии тестирования в домашних условиях. С точки зрения общественного здравоохранения, самотестирование может с пользой дополнить тесты по месту оказания медицинской помощи, позволяя проводить тестирование в более глобальном масштабе. Самотестирование, если оно надежно, позволяет людям получить быстрый результат, тем самым способствуя раннему выявлению и изоляции случаев COVID-199. Эти инструменты могут быть необходимы для крупномасштабного распространения диагностических тестов на COVID-19, и поэтому FDA уже одобрил несколько домашних тестов на антигены, а Управление здравоохранения Франции (Haute autorité de Santé [HAS]) определило минимальные требования к эффективности этих тестов с акцентом на необходимость проведения исследований в реальных условиях.10, 11, 12 Диагностическая эффективность теста быстрого обнаружения COVID-VIRO® (AAZ, LMB) на основе антигена уже была оценена на образцах носоглотки, выполненных обученными специалистами.13 Целью этого исследования было оценить диагностические производительность COVID-VIRO® с использованием метода забора мазка из носа по сравнению с эталонным методом, а также его применимость в качестве самотестирования, адаптированного для населения в целом.

      2. МАТЕРИАЛЫ И МЕТОДЫ

      Исследование было оценено и одобрено французским комитетом по этике (Comité de Protection des Personnes Nord-Ouest IV) в октябре 2020 года, и о нем было сообщено французскому органу по защите данных.Это исследование было проведено в соответствии с Хельсинкской декларацией. Это означает, что все участники предоставили письменное информированное согласие до прохождения какой-либо процедуры, специфичной для исследования. Были использованы две разные исследовательские установки: одна для исследования производительности и одна для исследования удобства использования/практичности:

      Исследование эффективности проводилось в двух отделениях COVID Регионального госпиталя Орлеана: больнице Ла-Мадлен и больнице Ла-Сурс. Критерии включения были следующими: взрослые добровольцы (старше 18 лет) с симптомами легкой и средней степени тяжести, длящимися менее 7 дней и не требующими немедленной госпитализации (головная боль, утомляемость, лихорадка, боль в горле, ломота и боли, потеря обоняния и вкуса, и т. д.). Критериями невключения были: госпитализированные пациенты, симптоматические пациенты с продолжительностью симптомов более 7 дней, бессимптомные пациенты или бессимптомный контакт с известным случаем.

      Что касается исследования юзабилити, взрослые добровольцы, принявшие участие, были пациентами лаборатории медицинского анализа (лаборатория Друо), а также пациентами-добровольцами, консультирующими в нашем инфекционном отделении или госпитализированными в наше отделение COVID (Орлеанская региональная больница). Никаких конкретных критериев включения/невключения не применялось.

      2.1. Исследуемое устройство для диагностики in vitro

      COVID-VIRO® (AAZ-LMB) представляет собой иммунохроматографический тест с латеральным потоком, в котором используются высокочувствительные моноклональные антитела для обнаружения ядерного антигена SARS-CoV-2 в назальном образце. В тесте используются моноклональные антитела к основному белку SARS-CoV-2, прикрепленные к тестовой зоне (T) на полоске из нитроцеллюлозы (рис. ). Моноклональное антитело к коровому белку SARS-CoV-2, меченное коллоидным золотом, используется в качестве лиофилизированного конъюгата.

      Внешний вид тест-кассеты COVID-VIRO® и представление возможных результатов антигенный комплекс.Этот комплекс по капиллярам мигрирует через мембрану к тестовой линии (T, рисунок ), где он захватывается связанными с мембраной моноклональными антителами против SARS-CoV-2. Цветная тестовая линия появляется в окне результатов (T), если в образце присутствуют антигены SARS-CoV-2. Интенсивность цветной тестовой линии будет варьироваться в зависимости от количества антигена SARS-CoV-2, присутствующего в образце. Если в образце нет антигена SARS-CoV-2, тестовая линия не будет окрашена (T). Контрольная линия используется в качестве процедурного контроля и всегда должна появляться в контрольной области (С), если процедура тестирования выполняется правильно.Визуальную интерпретацию результата можно проводить через 15 мин.

      2.2. Компаратор

      Тест ОТ-ПЦР на SARS-CoV-2 был проведен в вирусологическом отделении CHR Орлеана, Франция. Экстракцию нуклеиновых кислот проводили с помощью автоматизированной системы пробоподготовки МГИСП-960 (МГИ). Обнаружение РНК SARS-CoV-2, нацеленной на гены ORF1ab, S и N, методом ПЦР в реальном времени выполняли с помощью набора TaqPath V2 COVID-19 Multiplex RT-PCR kit (Thermo Fisher Scientific). Амплификацию проводили на QuantStudio5 (Applied Biosystems).Результаты анализа были выполнены в соответствии с инструкциями производителя. Анализ включает внутренний контроль выделения РНК и контроль амплификации. Образцы были проанализированы с учетом новых критериев положительности экспертного комитета Французского микробиологического общества (версия 4 от 14 января 2021 г.), в частности с учетом специфических характеристик набора Thermo Fisher Scientific, используемого для измерения ОТ-ПЦР.

      2.3. Методология

      2.3.1. Исследование производительности

      По прибытии в один из двух исследовательских центров пациенты были зарегистрированы для проведения назофарингеального ОТ-ПЦР-тестирования. Подходящие пациенты были проинформированы об исследовании. После согласия на участие обученная медсестра провела тест мазка из носа на COVID-VIRO® и записала результат теста в ранее заполненную форму сбора, не сообщая его пациенту. Затем медсестра берет мазок из носоглотки для проведения ОТ-ПЦР в лаборатории больницы. Тест ОТ-ПЦР был выполнен с использованием мультиплексной ОТ-ПЦР TaqPath V2 COVID-19 от Thermo Fisher Scientific, включая скрининг вариантов.Затем результат ОТ-ПЦР был сообщен пациенту в течение 24 часов и записан в карту пациента.

      2.3.2. Исследование удобства использования
      2.3.2.1. Подисследование 1: Понимание инструкций и выполнение теста

      Каждому участнику было предложено ознакомиться с инструкциями по использованию (письменно или видео, только на французском языке, доступны в дополнительном файле 1 и по следующей ссылке: https://www.youtube.com /watch?v=lP8sPqMFJkA) полностью перед выполнением самопроверки. Затем каждого человека попросили использовать назальный тампон из набора, взять глубокий назальный мазок из обеих ноздрей, окунуть тампон в подушечку с разбавителем, закрыть подушечку и разбавитель, закрыть дозатор разбавителя крышкой-капельницей и закапать четыре капли. образца в лунку и получить действительный результат (дополнительный файл 1).Каждому участнику было предложено прокомментировать различные этапы самопроверки в анкете (таблица). Человек, проводивший тест, находился под наблюдением наблюдателя (сотрудника лаборатории, медсестры или врача), который давал апостериорную оценку выполнения различных шагов, заполняя форму оценки для каждого участника (таблица).

      Таблица 1

      Таблица 11

      УДАЛЕНИЯ УДАЛЕНИЯ COVID-VIRO®

      Анкета использования Юзабили
      9115
      □ Плохо □ Хорошо □ Очень хорошо □ Отлично
      □ Плохо □ Хорошо □ Очень хорошо □ Отлично
      □ Трудно □ Легко □ Очень просто
      □ Сложно □ Легко □ Очень легко
      9
      Анкета руководителя
      Вопрос
      □ Да □ Нет
      □ Плохо □ Хорошо □ Очень хорошо
      2.3.2.2. Подисследование 2: Интерпретация результатов теста

      Исследование юзабилити также включало упражнение по интерпретации результатов теста, во время которого наблюдатель инструктировал участника случайным образом выбрать 1 из 5 самотестов (1 отрицательный, 2 положительных и 2 недействительных, рисунок  ), прочитать и дать свою интерпретацию результата. Интерпретация участника, а также его / ее мнение о простоте интерпретации были собраны в анкете (таблица).

      Пробные тесты использовались для интерпретационного исследования.Кассеты A — отрицательный тест, B и C — недействительные тесты, а образцы D и E — положительные тесты (D слабоположительный и E сильноположительный)

      □ Без полосы □ 1 полоса □ 2 полосы
      □ Отрицательный □ Положительный □ Неубедительный
      □ Трудно □ Легко □ Очень просто
      □ Сложно □ Легко □ Очень просто

      2.4. Анализ данных

      2.4.1. Исследование производительности

      Совокупность описывалась в процентах, среднем значении, стандартном отклонении, диапазоне и медианном значении. Данные испытаний были проанализированы в инфекционном отделении. Истинно положительные (TP) результаты определялись как положительные люди в соответствии с эталонным методом, которые считались положительными в тесте на COVID-VIRO®, FP (ложноположительные) результаты были отрицательными в соответствии с эталонным методом, которые считались положительными в тесте на COVID-VIRO®, FN (ложноотрицательные) были положительными людьми в соответствии с эталонным методом, которые считались отрицательными в тесте на COVID-VIRO®, а VN (истинно отрицательные) определялись как отрицательные люди в соответствии с эталонным методом, которые считались отрицательными в тесте на COVID-VIRO®.Специфичность (Sp), чувствительность (Se), положительное прогностическое значение (PPV; вероятность того, что субъекты с положительным скрининговым тестом действительно болеют) и отрицательное прогностическое значение (NPV, вероятность того, что субъекты с отрицательным скрининговым тестом действительно не болеют). t имеют заболевание) теста COVID-VIRO® по сравнению с эталонным тестом (ОТ-ПЦР) рассчитывали по следующим формулам:

      • – Sp (%) = 100 × [TN/(TN + FP)]
      • – Se (%) = 100 × [TP/(TP + FN)]
      • – 0=[TP/(TP + FN)]
      • – PPV (%) 0 TP/(TP + FP)]
      • — NPV (%) = 100 × [TN/(TN + FN)]

      Доверительные интервалы для чувствительности были получены с помощью метода оценки Вильсона.

      2.4.2. Исследование юзабилити

      Популяции были описаны в терминах абсолютного числа и процента.

      3. РЕЗУЛЬТАТЫ

      3.1. Исследование эффективности

      Всего было набрано 239 пациентов из двух центров COVID в городе Орлеан. Эти участники были распределены следующим образом: 94/239 (39%) из больницы Ла-Сурс и 145/239 (61%) из больницы Ла-Мадлен. Из этих 239 пациентов пять были исключены, так как их ОТ-ПЦР считались сомнительными в соответствии с классификационными критериями Французского микробиологического общества.14 В частности, четыре из этих пяти пациентов являются положительными по ОТ-ПЦР в отношении гена N, но имеют значение Ct выше 32 (26, 34, 37 и 37 соответственно) по сравнению со средним значением Ct, равным 24. Последний образец был RT-PCR. Положительный ПЦР для гена ORF со значением Ct 38, тогда как среднее значение Ct было 25. Эти образцы положительны с лабораторной точки зрения, но выделяют очень низкий (Ct > 32 в соответствии с французскими рекомендациями14) уровень SARS-CoV-2. вирус, что означает, что они больше не заразны. Следовательно, согласно французским рекомендациям, лаборатория может считать их либо слабо положительными, либо отрицательными.Поэтому они были исключены из анализа. Таким образом, исследуемая популяция включает 234 пациента. Соотношение полов в исследуемой популяции составило 0,70 (98 мужчин и 141 женщина). Средний возраст составил 34 года (средний: 38 лет, диапазон: 24 года). Среди этой популяции средняя продолжительность симптомов до даты отбора проб составляла 2 дня (среднее значение: 2,56, диапазон: 7). По результатам теста ОТ-ПЦР были сформированы две группы: 32 положительных и 202 отрицательных образца. Из 32 положительных образцов шесть были подтверждены положительными для английского варианта (VOC 2020-12/01), а один был заподозрен.Результаты представлены в таблице.

      Таблица 3

      Таблица 3

      Производительность антигенного теста COVID-VIRO®

      Всего N = 234
      True Plantifian Н 234
      VP 31 (13,2%)
      Ложноположительный результат Н 234
      ФП 0 (0.0%)
      Ложноотрицательный Н 234
      FN 1 (0,4%)
      Истинно отрицательный Н 234
      ВН 202 (86,3%)

      В общей популяции тест на COVID-VIRO® проводился следующим образом:

      • ‐ Чувствительность: 96,88 % (95 % доверительный интервал [ДИ]: 83,78–99,92 %).
      • — Специфичность: 100% (95% ДИ: 98,19–100,00%
      • — Положительная прогностическая ценность: 100%
      • — Отрицательная прогностическая ценность: 99,5% (95% ДИ: 96,70%–99,93%)
          • результаты между ОТ-ПЦР и COVID-VIRO® наблюдались у 233 (99,6%) пациентов. 3.2 Исследование юзабилити
            3.2.1 Подисследование 1: Понимание инструкций и выполнение теста

            Всего в исследовании принял участие 101 человек.Ни один из них не был исключен, поэтому анализ проводился на 101 участнике. Перераспределение испытуемых приведено в табл.

            Таблица 4

            Таблица 4

            УДАЛИТЬ УДАЛИТЬСЯ ИССЛОЖЕНИЯ ЧУЖДЕНИЯ

            N (%)
            Trouot Laboratory 64 (63,4)
            Chr Orleans Инфекционные заболевания 31 (30.7)
            CHR Orléans COVID unit 6 (5.9)

            Среди этих 101 участников только один человек не получил достоверный результат, 94 (93,1%) получили достоверный отрицательный результат и 6 (5,9%) достоверный положительный результат. Эти результаты показывают, что 99,0% неподготовленных людей, которые использовали самотестирование COVID-VIRO®, смогли получить достоверный интерпретируемый результат (с одной видимой контрольной полосой). Недействительный тест был следствием плохого выполнения (только три капли образца были нанесены на кассету вместо четырех, как указано в инструкции).

            Что касается качества инструкций по самодиагностике COVID-VIRO®, то 84,16% участников сочли качество письменных инструкций очень хорошим или отличным, и только один участник ответил на этот вопрос «плохо». Точно так же 78,22% сочли обучающее видео очень хорошим или отличным. На этот вопрос никогда не давался отрицательный ответ. Эти результаты показывают, что 99% и 100% участников (письменные инструкции и видео соответственно) считают инструкции хорошими или лучше.Что касается простоты сбора образцов COVID-VIRO® (мазок из носа), то 100 % участников сочли его легким или очень легким (26,7 % и 73,3 % соответственно). Аналогичным образом, процедуры самотестирования на COVID-VIRO® были сочтены всеми участниками простыми или очень легкими (33,7% легкими и 66,3% очень легкими). Во время выполнения теста каждый участник находился под наблюдением квалифицированного специалиста (врача, медсестры или лаборанта) и имел возможность запросить его/ее помощь.Только 6/101 (5,9%) участников обратились за помощью к супервайзеру. Затем супервайзер должен был оценить качество выполнения тестовых процедур участником. Только 2/101 (2%) испытуемых были признаны плохо выполняющими тестовые процедуры, тогда как 99 (98%) были оценены как хорошие или очень хорошие (36/101 — 35,6% и 63/101 — 62,4% соответственно). . Наиболее частым наблюдением было то, что некоторые испытатели встряхивали тампон внутри пробирки для разбавления, не прижимая его к стенке пробирки.

            3.2.2. Подисследование 2: Интерпретационное исследование

            Все испытуемые, участвовавшие в подисследовании 1, были включены в подисследование 2, которое заключалось в случайном выборе одного теста из пяти контрольных тестов, а также в правильном его чтении и интерпретации. Среди всех участников 27 отсортировали отрицательный тест, 28 — недействительный тест и 46 — положительный тест (сильный или слабый). В целом 98% участников (99/101) правильно интерпретировали отсортированный тест, а 2% (2/101) неверно истолковали тест. Однако эти два испытуемых правильно прочитали тест (определили правильное количество полос), но не смогли его интерпретировать.Из этих двух участников один интерпретировал недействительный тест как отрицательный, а один интерпретировал положительный тест как недействительный. Следует отметить, что положительный тест, который был интерпретирован как недействительный, показал сильную тестовую полосу (образец E, рисунок ). Подавляющее большинство участников (98/101 — 97%) обнаружили, что этапы чтения и интерпретации COVID-VIRO® были легкими или очень легкими (37/101 — 36,6% и 61/101 — 60,4% соответственно), в то время как только 3/ 101 (3%) оценили эти шаги как сложные.

            4. ОБСУЖДЕНИЕ

            Предыдущее проспективное исследование диагностической эффективности быстрого антигенного теста COVID-VIRO® (AAZ-LMB) в реальных условиях на образцах из носоглотки было проведено в октябре 2020 года.13 В то время эффективность теста была очень похожа на эталонный метод, поскольку специфичность и чувствительность составляли 100% и 96,6% соответственно, что превышало требования Национального управления здравоохранения Франции (HAS) (чувствительность ≥ 80% и специфичность ≥ 99%) 12 и Всемирная организация здравоохранения (ВОЗ).15 Текущее исследование было проведено с использованием тампона, специально адаптированного для забора проб из носа, чтобы сделать тест доступным для неспециалистов. Результаты показали, что этот метод выборки не повлиял на характеристики теста, так как специфичность снова оказалась равной 100%, а чувствительность была оценена на уровне 96.8%. Таким образом, это исследование демонстрирует диагностическую эффективность теста COVID-VIRO® на образце из носа. Этот результат согласуется с другим исследованием, показывающим аналогичные результаты с экспресс-тестом на антиген от другого производителя. ниже при выполнении неподготовленным человеком или в домашних условиях, они все еще находились в пределах приемлемого диапазона, и поэтому необходимо поощрять разработку самотестирования RADT и проводить дальнейшие исследования.17, 18

            В нашем исследовании распространенность случаев COVID-19 составила 14%, что отражает ситуацию во Франции в то время. В этом контексте отрицательные и положительные прогностические значения были очень высокими (99,5% и 100% соответственно). Однако, поскольку PPV теста снижается с уменьшением распространенности, было бы интересно оценить эффективность теста в популяции с более низкой распространенностью COVID-19. Отрицательная прогностическая ценность также снижается в условиях низкой распространенности, но в несколько меньшей степени.Однако низкий NPV может нанести ущерб усилиям по сдерживанию эпидемии, поскольку люди с отрицательным результатом теста RADT могут участвовать в социальном смешивании или проявлять небрежное поведение на основании того факта, что у них отрицательный результат теста.9

            В дополнение к оценке производительности мы провели исследование удобства использования в соответствии с рекомендациями FDA.19 Участника попросили прочитать или просмотреть инструкции по тестированию и выполнить все процедуры под наблюдением, чтобы оценить, смог ли участник правильно выполнить тест самостоятельно и правильно интерпретировать его.Из-за настройки этого испытания (частные и государственные лаборатории в двух разных городах) в исследование было включено большое количество людей разного возраста, уровня образования и социально-экономического положения. Это привело к репрезентативной выборке французского населения в целом. Инструкции по тесту, письменные или видео, были положительно оценены подавляющим большинством участников как хорошо написанные/сделанные и понятные, что свидетельствует о том, что удобочитаемость документов, прилагаемых к тесту на COVID-VIRO®, особенно высока и должна быть доступна для широкий круг лиц.Результаты показали, что тест COVID-VIRO® очень практичен, поскольку только небольшая часть участников не смогла получить достоверные и интерпретируемые результаты. Более того, почти все участники смогли выполнить тестовые процедуры, не обращаясь за помощью к супервайзеру, и их выполнение было высоко оценено супервайзерами. С точки зрения удовлетворенности, когда их спросили об их мнении о простоте использования COVID-VIRO®, все участники заявили, что сбор образцов или последующие процедуры тестирования были простыми или очень простыми в выполнении.Тем не менее, очень небольшая часть участников сочла этапы чтения и интерпретации довольно сложными. Это, однако, не повлияло на их способность правильно интерпретировать результаты теста, за одним заметным исключением. В совокупности эти результаты показывают, что тест COVID-VIRO® в высокой степени адаптирован для использования непрофессионалом.

            Насколько нам известно, это первое исследование применимости назального экспресс-теста на антиген, сочетающее простой метод отбора проб (назальный мазок) с высокоточным диагностическим тестом, что должно позволить органам здравоохранения рассмотреть возможность более широкого использования этого теста (дети, итеративные скрининг, …) медицинскими работниками, а также его адаптация в версии для самопроверки для использования непрофессионалами.Назальные тесты представляют особый интерес, поскольку они могут снизить риски и побочные эффекты назофарингеальных тестов (дискомфорт, боль, более глубокие поражения и т. д.) и хорошо подходят для ситуаций, когда нет подготовленного специалиста, например, в общественных местах, в офисах и школах. . Однако важно учитывать, что, как указывает Европейское агентство по лекарственным средствам, использование RADT населением в целом вызывает опасения по поводу занижения данных. Поэтому в интересах глобальных усилий по сдерживанию распространения вируса может оказаться необходимым включить набор инструкций, побуждающих пользователей тестирования сообщать о любых положительных результатах.9

            КОНФЛИКТ ИНТЕРЕСОВ

            Авторы заявляют об отсутствии конфликта интересов. Ответственность за содержание и написание статьи несут исключительно авторы.

            ВКЛАД АВТОРОВ

            Разработка экспериментальной стратегии : Тьерри Празук, Рафаэль Серро и Нино Г. Кассуто. Эксперименты : Энн Гравье, Матильда Колин, Орели Тиеллай, Даниэла Пирес-Ротейра и Сандра Паллай. Курирование данных , Тьерри Празук. Рукопись : Тьерри Празук, Лоран Окелу и Рафаэль Серро. Редактирование рукописи : Тьерри Празук и Нино Г. Кассуто.

            БЛАГОДАРНОСТИ

            Авторы хотели бы поблагодарить технический персонал отдела инфекционных болезней за их отличную помощь. Кроме того, авторы благодарят Thibaut de Sablet из Clinact, Франция, за помощь в написании медицинских текстов/редакционную поддержку в соответствии с рекомендациями по надлежащей практике публикации (GPP3).

            Примечания

            Cassuto NG, Gravier A, Colin M, et al. Оценка экспресс-теста для обнаружения антигена SARS-CoV-2 в качестве самотестирования: диагностические характеристики и удобство использования. J Med Virol. 2021;1-7. 10.1002/jmv.27249 [Бесплатная статья PMC] [PubMed] [CrossRef]

            ЗАЯВЛЕНИЕ О НАЛИЧИИ ДАННЫХ

            Данные, подтверждающие результаты этого исследования, можно получить у соответствующего автора по обоснованному запросу.

            ССЫЛКИ

            2. Rothan HA, Byrareddy SN.Эпидемиология и патогенез вспышки коронавирусной болезни (COVID-19). J Аутоиммун. 2020;109:102433. [Бесплатная статья PMC] [PubMed] [Google Scholar]3. Горбаленя А.Е., Бейкер С.К., Барич Р.С. и соавт. Коронавирус, связанный с тяжелым острым респираторным синдромом: вид и его вирусы – заявление Исследовательской группы по коронавирусу [Интернет] Микробиология . Опубликовано в Интернете 4 мая 2020 г. https://biorxiv.org/lookup/doi/10.1101/2020.02.07.937862 5. Салливан С.Б., Швалье А.Т., Дженсен М. и соавт. Утечка спинномозговой жидкости после тестирования мазка из носа на коронавирусную болезнь 2019 г.JAMA Otolaryngol–Head Neck Surg. 2020;146(12):1179-1181. [PubMed] [Google Scholar]6. Альберола-Аморес Ф.Дж., Вальдеоливас-Урбелз Э., Торрегроса-Ортис М., Альварес-Сауко М., Алом-Поведа Дж. Менингит из-за утечки спинномозговой жидкости после тестирования мазка из носа на COVID-19. Евр Дж Нейрол. 2021. 10.1111/en.14736 [бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]7. Föh B, Borsche M, Balck A, et al. Осложнения мазков из носа и глотки: актуальная проблема пандемии COVID-19? Eur Respir J. 2021;57(4):2004004.[Бесплатная статья PMC] [PubMed] [Google Scholar]8. Хунг К.Ф., Сунь Ю.К., Чен Б.Х. и др. Новый тест на COVID-19 на основе слюны: насколько он хорош по сравнению с текущим тестом мазка из носоглотки или горла? J Chin Med Assoc. 2020;83(10):891-894. [Бесплатная статья PMC] [PubMed] [Google Scholar]

            11. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов. FDA продолжает продвигать разработку безрецептурных и других скрининговых тестов [Интернет]. 2021; Следует отметить, что действительный тест, который был интерпретирован как недействительный, был действительным тестом с сильным тестовым диапазоном.

            13. Courtellemont L, Guinard J, Guillaume C, et al. Высокая эффективность нового теста на обнаружение антигена в образцах из носоглотки для диагностики инфекции SARS-CoV-2. J Med Virol. 2021;93(5):3152-3157. [Бесплатная статья PMC] [PubMed] [Google Scholar]14. Французское общество микробиологии . Avis SFM от 25.09.2020 relatif à l’interprétation de la valeur de Ct (оценка вирусного заряда), полученная в cas de RT-PCR SARS-CoV-2 положительный — Версия 4 от 14/01/2021Avis от 25 сентября 2020 de la Société Française de Microbiologie (SFM) Relatif à l’interprétation de la valeur de Ct (оценка вирусного заряда) obtenue en cas de RT-PCR SARS-CoV-2 положительный на les prélèvements cliniques à des fins diagnostiques ou de dépistage [Интернет].2021 г. https://www.sfm-microbiologie.org/wp-content/uploads/2021/01/Avis-SFM-valeur-Ct-excre%CC%81tion-virale-_-Version-def-14012021_V4.pdf 16. Линднер А.К., Николай О., Кауш Ф. и соавт. Прямое сравнение экспресс-теста на выявление антигена SARS-CoV-2 с мазком из носа, взятым самостоятельно, и мазком из носоглотки, взятым профессионалом. Eur Respir J. 2021;57(4):2003961. [Бесплатная статья PMC] [PubMed] [Google Scholar]17. Пето Т. COVID-19: быстрое обнаружение антигена SARS-CoV-2 с помощью анализа латерального потока: национальная систематическая оценка массового тестирования.

            Похожие записи

            При гормональном сбое можно ли похудеть: как похудеть при гормональном сбое

            Содержание Как похудеть после гормональных таблетокЧто такое гормональные таблеткиПочему прием гормонов ведет к избыточному весу (adsbygoogle = window.adsbygoogle || []).push({}); […]

            Гипотензивные средства при гиперкалиемии: Гипотензивные средства при гиперкалиемии — Давление и всё о нём

            Содержание Препараты, применяемые для лечения гипертонической болезни | Илларионова Т.С., Стуров Н.В., Чельцов В.В.Основные принципы антигипертензивной терапииКлассификация Агонисты имидазолиновых I1–рецепторов […]

            Прикорм таблица детей до года: Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственном

            Содержание Прикорм ребенка — таблица прикорма детей до года на грудном вскармливании и искусственномКогда можно и нужно вводить прикорм грудничку?Почему […]

            Добавить комментарий

            Ваш адрес email не будет опубликован.